Human Cloning – Brain Ethics http://brainethics.org/ Sat, 18 Sep 2021 01:39:27 +0000 en-US hourly 1 https://wordpress.org/?v=5.8 https://brainethics.org/wp-content/uploads/2021/05/brain-ethics-icon-150x150.png Human Cloning – Brain Ethics http://brainethics.org/ 32 32 Phylogeographic reconstruction of the origin of marbled crayfish https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/ https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/#respond Fri, 17 Sep 2021 09:14:48 +0000 https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/

Procambarus fallax PCR collections and genotyping

Animals were collected from various wild populations (Table S1) in accordance with state and local regulations (Georgia Department of Natural Resources Scientific Collection Permit 115621108, Florida State Collection Permit S-19-10 and S- 20-04). DNA was isolated from abdominal muscle tissue using SDS-based extraction and precipitation with isopropanol. PCR genotyping of 92 specimens was carried out using the following primer pairs: Cytb (FWD CAGGACGTGCTCCGATTCATG and REV GACCCAGATAACTTCATCCCAG), Dnmt1 (FWD GCTTTCTGGTCTCGTATGGTG and REV CTGCACACAGCCD CATTGATGACT (CTATT). Amplicons were verified by agarose gel electrophoresis and cloned using the TOPO TA cloning kit (Invitrogen) according to the manufacturer’s instructions. The purified plasmids were sequenced by eurofins genomics and the sequences were aligned using SnapGene software.

Procambarus virginalis Sequencing and assembly of the PacBio genome

Genomic DNA was isolated from three independent animals using SDS extraction and precipitation with isopropanol. The preparation of the large PacBio insert library was performed following the protocols recommended by Pacific Biosciences. For each animal, a library was generated of 1 to 5 μg of sheared and concentrated DNA with a target of insert size of approximately 10 kb. After preparation of the library, the sequencing was performed on a PacBio SEQUEL platform according to the manufacturer’s instructions. Film times were 600 for most SMRT cells, some being 240, 360 and 900. Sequencing results for animals were pooled, resulting in a total of 37 SMRT cells comprising 69,074,290 reads and 242,146,920,794 bases.

The long sub-reads generated from the PacBio SEQUEL platform were assembled into contigs using the Canu assembler25 version 1.7. After automatic error correction and cropping for the read quality estimates and the SMRT cell adapters, the remaining 31,652,687 reads, comprising 91,697,556,862 bp, were used in the assembly phase. The calculations were performed on a high performance cluster running Slurm Workload Manager using up to 56 processors and 450 GB of memory. To obtain an improved representation of the genes, the contigs were connected using information from the transcriptome. In short, all the transcripts were mapped to the contig assembly and the linkage information was extracted to connect the contigs using L_RNA_SCAFFOLDER26 version 1.0. Sequence adjacency was improved using proximity ligation based on the Chicago and Hi-C methods (supplied by Dovetail Genomics, Chicago, USA) using fresh frozen tissue from an additional animal. After DNA extraction and library preparation, the libraries were on an Illumina HiSeq X platform using a 150 bp sequencing protocol without PCR. Readings were processed for scaffolding and error correction using the HiRise scaffold pipeline from Dovetail (Dovetail Genomics, Chicago, USA).

Automatic annotation was performed as described previously8. Briefly, sequences greater than or equal to 10 kb were extracted from the assembly and annotated using the MAKER pipeline.27 version 3.00. The annotation data was provided by the manually managed Uniprot / Swiss-Prot database28 and the annotated marbled crayfish transcriptome8. Functional domains were predicted using InterproScan29 versions 5.39–77.0.

In order to assess the quality of the assembly, a defined set of single copy orthologous arthropod genes was searched in all sequences using BUSCO.18 version 4.1.4. BUSCO was run using the default settings in genome mode with the provided arthropod sequence database, containing a total of 1066 orthologs from the arthropoda_odb10 database. The taxonomic query was performed using blobtools30 version 1.1.1, the P. virginalis Petshop 1 WGS Dataset8, and the blast nucleotide database as the hits database. Blobtools was run according to the workflow provided by first creating a BlobDB database using standard parameters, followed by a visualization.

Procambarus fallax whole genome sequencing

Illumina libraries for 28 samples were prepared by the DKFZ Genomics and Proteomics Core Facility using standard and sequenced procedures on an Illumina HiSeq X platform (PE150 protocol). Raw reads were cropped and filtered using Trimmomatic31 version 0.32.

Analysis of whole genome sequencing data

Cropped and processed reads were mapped to the P. virginalis mitochondrial genome sequence (Genbank KT074364.1) or on V1.0 genome assembly using bowtie232 version 2.1.0. Alignment files have been converted to BAM format and duplicates have been removed with SAMtools33, version 1.9. In addition, the alignment files have been filtered for reference sequences greater than 10 kbp. Multi-sample SNV profiles were calculated for batches of P. fallax animals using freebayes (https://arxiv.org/abs/1207.3907, version v0.9.21-7-g7dd41db) with a ploidy parameter for diploid organisms. Variant sites obtained from vcf files were subjected to linkage pruning using PLINK34 version 1.9 and specific window settings (50 KB), window step sizes (10 bp), and R2 threshold (> 0.1). The resulting set of variants was used for principal component analysis (PCA) using the default settings in PLINK and plotted using the ggplot2 package in R (version 3.2.1). The alignment files for the mitochondrial genomes were used for the consensus call by the SAMtools bcftools package. The consensus sequences obtained from P. fallax mitochondrial genomes with P. virginalis Reference mitochondrial genome were aligned using Clustal Omega with default settings. For the resulting multiple sequence alignment, a phylogenetic tree was constructed by the maximum likelihood method implemented in PhyML35 (v3.1 / 3.0). The tree in Newick format was visualized via the Interactive Tree of Life online tool36, with statistical branch support evaluated by the bootstrap method37.

To detect parental nuclear alleles of P. virginalis, SNV profiles of all P. fallax the animals were compared to the set of heterozygous mottled positions specific to crayfish. A matrix was constructed for each mottled crayfish allele (majority and minority allele) containing either 0 or 1, representing the presence or absence of the respective alleles in P. fallax animals. A neighbor-to-join distance matrix was calculated for each allele and an unrooted tree was plotted using the APE38 version 5.3. To identify triploid genomes, biallelic heterozygous variants were extracted from SNV profiles. By focusing only on the reference alleles, homozygous single-nucleotide polymorphisms in P. fallax were thrown away. For each variant position, the alternate allele frequencies were calculated as the number of observations of alternate allele readings divided by the total reading depth. Finally, frequencies were plotted using the histogram routine in R (version 3.6.1).

Statistics and reproducibility

All statistical methods and visualizations were performed using publicly available tools and packages of Statistical Calculation Framework R. Individual packages, settings and version numbers are mentioned in the respective sections. Link pruning was done using PLINK34 (v1.9) and one internal r2 statistical threshold of> 0.1 for the squared correlation of the numbers of raw intervariant alleles. Principal component analysis was performed using the internal default R function with standard parameters. The reconstruction of the phylogenetic tree was carried out by the maximum likelihood method implemented in PhyML35 (v3.1 / 3.0) with default settings. Here, the statistical support for each branch was assessed using the bootstrap method37. Histogram plots for heterozygous allele frequencies were generated using the default internal R histogram function (v3.6.1).

This study includes data for the PCR genotyping of NOT = 92 P. fallax specimens. For each animal, the total number of genetic polymorphisms on 3 gene fragments was extracted and plotted on a scale of 0 (minimum) to 21 (maximum) using the internal R (v3.5.0) heat map function with parameters by default. In addition, data from NOT = 4 copies of P. alleniwere sequenced and integrated. Replicates were defined as a group of individuals with distinct animals of a species (i.e., NOT = 92 for P. fallax and NOT= 4 for P. alleni). Analysis of whole genome sequencing data was performed on NOT= 28 P. fallaxanimals collected from 23 independent collection sites in Florida and South Georgia. Besides, NOT= 2 publicly available WGS datasets from P. virginalissamples were taken into account for this study. Here, repeats were also defined as the number of individual animals of a species.

Summary of the report

Further information on the research design can be found in the Nature Research Report Summary linked to this article.

Source link

]]>
https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/feed/ 0
How to watch alien movies in order https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/ https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/#respond Thu, 16 Sep 2021 23:29:00 +0000 https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/

“Alien” takes place in 2122, 17 years after “Alien: Covenant”. But, despite this short span of time, there is a lot going on in between. “Covenant” continued to put vital information into spin-off media. Peter Weyland’s company became Weyland-Yutani not on screen, but in a book by Alan Dean Foster. “Origins,” released months after the film’s debut, describes how Yutani’s CEO attacked Weyland Corp after Peter’s death, explaining why the settlers were flying under a familiar corporate banner.

There were also two other “Alien: Covenant” shorts produced after the film’s release. One, “Advent”, was included on the DVD. This is David’s thesis on how to create a higher being, posted to Weyland-Yutani. In grotesque autopsy footage, David defiles Dr. Shaw as he talks about perfecting his creation. “Advent” also makes it clear that Daniels, one of the two surviving Alliance settlers, is destined to be part of the first Queen Xenomorph. It is an act that will ensure the future replication of the species.

The other movie, “David’s Lab – Last Signs of Life”, was released on YouTube as a birthday present. Twelve minutes is too slow for what it offers. Weyland-Yutani sent an expedition to study David’s lab, and of course one of David’s new facehuggers takes a bite out of the newcomers.

Source link

]]>
https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/feed/ 0
Supergirl: Season 6, Episode 11 recap and spoilers https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/ https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/#respond Thu, 16 Sep 2021 21:21:28 +0000 https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/

WARNING: The following contains spoilers for Supergirl Season 6, Episode 11, “Mxy in the Middle,” which aired Tuesday on The CW.

Season 6 of Super girl built the menace of the 5th dimensional pixie princess Nyxlygsptlnz as the series’ final cosmic menace. Picking up where “Still I Rise” left off, “Mxy in the Middle” begins with the arrival of Mister Mxyzptlk, also known as Mxy, after being summoned by Supergirl. The other 5th dimensional pixie comes to her aid against the princess, defending Supergirl from Nyxly’s blasts. The two manage to escape and regroup with J’onn and the others, without Kelly facing the fallout from the building destroyed by Nyxly.


Unable to do magic without Nyxly tracking him down, Mxy performs a musical number to the tune of “I Will Survive”, with the lyrics exchanged for Nyxly’s life story. Nyxly and her brother conspired to overthrow their father, Mad King Brpxz, but were caught red-handed. The king disowned Nyxly, while his brother received praise for his ferocity. While showing how the fictional patriarchs are just as unfair as the real ones, this story is the opposite of what Nyxly initially told Kara. She stated that King Brpxz killed her brother, although Mxy believes she was speaking metaphorically, as Nyxly considers her brother to have died for her.

RELATED: Supergirl: CatCo Can’t Beat Iris West’s Beloved Citizen Report

supergirl mxy singing for i will survive

The most important part of Mxy’s song is about the AllStone, an incredibly powerful item created by an evil pixie named Jyrryd. The AllStone was meant to give the Imp in control of everything, even life and death. The other 5th dimensional imps weren’t so excited about his plan, banishing Jyrryd and blowing up the AllStone. The broken pieces have become totems. Every planet has a set, according to Mxy. Nyxly wants to collect the totems to create a new AllStone, although this is made difficult by the fact that the totems can be disguised as anything. To get around this, she uses a crystal owned by Jyrryd that can hunt down totems, though she needs one more thing for this to work: a descendant of Jyrryd to stay inside the orb. In a somewhat convenient twist, Mxy reveals that he is Jyrryd’s last descendant, making him Nyxly’s target.

Throughout the episode, Nia struggles with the guilt of being the one who freed Nyxly. This guilt is even worse when Kara begins to blame herself for Nyxly’s appearance, as she believes she brought Nyxly into the real world from the Phantom Zone. After confiding in Brainiac 5 and showing how far their relationship has come in terms of trust, Nia also reveals the truth to Supergirl. Expecting to be hated by her hero, Nia is relieved when Kara realizes that Nia simply made a mistake, as they all have done in the past.

Examining blueprints for the device Nyxly used to restore her powers, the Superfriends hatch a plan to use a magically powered sinking armband to weaken Nyxly. Mxy offers an amulet which he hid after Mon-El used it to fight the Imp. Without being able to use his magic, Mxy finds his help worthless as the team works on the device. Eventually summoned downtown to fight a giant cat summoned by Nyxly, the pixie gives the team a two-hour deadline to hand Mxy over. Mxy brings up the idea of ​​cloning himself to cheat Mxy, although his clone quickly disintegrates. Supergirl and Nia improve on this idea by having Nia take on the appearance of Mxy to get close enough to Nyxly to use the armband on her.

RELATED: Supergirl’s Final Season Presents a Landmark Guardian Moment

supergirl mxy and dreamy

Dreamer uses Brainy’s Image Inductor to mimic Mxy’s appearance, and she and Supergirl go to meet Nyxly. Unfortunately, the power-cushioning armband disrupts Dreamer’s illusion, which leads Nyxly to capture the Superfriends to lure Mxy. She summons a Kryptonite-breathing dragon to threaten the team, while also telling them how Mxy said he would support Nyxly in overthrowing her father, only for Mxy to vouch for her during the trial. Mxy arrives and saves the Superfriends, wanting to make up for his past actions, but gets captured by Nyxly in the process. While sealed in the orb, Mxy manages to get the Power Damping Armband on Nyxly before she returns to her ship.

The Superfriends regroup and agree to try to save Mxy while preventing Nyxly from recreating the AllStone. Mitch, the alien criminal used by Nyxly to help her regain her powers, only saved Nyxly so that she could give him a better life with her powers. Powerless again, Nyxly agrees to grant his wishes if they manage to find the totems, starting with the totem of courage. Nia sees this in her dreams, letting the Superfriends know what Nyxly’s next move is. It is not yet clear whether the totems are meant to be real people like the Paragons in Crisis were, or if they are just everyday items. Either way, Plot A ends with the set setting for the Superfriends to pursue Nyxly and save Mxy.

For the episode’s plot B, Lena is visiting her mother’s hometown. She and Andrea talk on the phone about a photo of Lena’s mother, Elizabeth, and her two childhood friends. Lena asks Andrea to locate a girl in the photo, Florence, which the CEO of CatCo happily accepts. Lena’s arrival in town is less than welcome, as bed and breakfast and pub owners are throwing her out. The owner of the pub, named Peggy, is the daughter of Margaret Bishop, the other woman pictured with Elizabeth and Florence. Peggy reveals to Lena that their mothers were in a coven together and that Elizabeth allegedly killed Margaret.

RELATED: Supergirl’s Chyler Leigh Teases Series Finale Full of Bittersweet Tears

supergirl lena with florence

Already overwhelmed by her Luthor side, Lena wants to give up and go home. Andrea calls back with information about Florence and urges Lena to continue searching for the truth. Arriving at what looks like a small hut in the woods, Lena finds Florence, who reveals that Elizabeth, Margaret and herself were in fact witches, who pursued Margaret’s husband after learning he was beating her. . What was intended as a scare tactic accidentally turned into murder when the three lost control of their magic and set the hangar on fire. Florence ends by telling Lena that she inherited her mother’s gift, which the scientist finds it hard to believe.

In terms of the main story, “Mxy in the Middle” does a great job of preparing for the home stretch by facing Nia’s guilt and focusing primarily on the battle to stop Nyxly. Foreground is Dreamer’s character development, with her able to interpret her dreams, while maintaining a healthy and honest relationship with Brainy. On the other hand, the plots of characters like Kelly and Lena seem to have gotten lost in the process. Kelly still hasn’t donned the Guardian armor, though the teaser for next week’s episode seems to finally be making its debut. With only a few episodes remaining on the show, it’s a shame Kelly didn’t have more time to dress up and show off her skills.

This leads to the other hanging story: Lena’s magical ability. Lena’s journey to find the motherly side of the family seemed like a natural progression for someone trying to get away from the craziness of her Luthor heritage. Elizabeth Walsh having a darker past than Lena knew, it even makes sense, but the sudden revelation that Lena’s mother was magical comes a little too late to do good. With only a few episodes remaining and one major threat to resolve, Lena’s development as a witch will be short and likely not so sweet for viewers who appreciated Lena as a great human character among the Superb. Lena’s magical abilities will likely play a role in the final battle against Nyxly, leaving it to fans to Super girl decide if another character becoming a superhuman so close to the end was really needed.

New episodes of Supergirl air Tuesdays on The CW.

KEEP READING: Why Supergirl Should End With No Romance For Kara

Marvel and if the Killmonger drones

Marvel just launched the MCU’s own Gundam army – with disastrous results


About the Author

Source link

]]>
https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/feed/ 0
Turing Award winner Barbara Liskov on CLU and why programming is always cool • The Register https://brainethics.org/2021/09/16/turing-award-winner-barbara-liskov-on-clu-and-why-programming-is-always-cool-the-register/ https://brainethics.org/2021/09/16/turing-award-winner-barbara-liskov-on-clu-and-why-programming-is-always-cool-the-register/#respond Thu, 16 Sep 2021 09:15:00 +0000 https://brainethics.org/2021/09/16/turing-award-winner-barbara-liskov-on-clu-and-why-programming-is-always-cool-the-register/

Maintenance It’s been 13 years since Barbara Liskov won a Turing Award for her contributions to the practical and theoretical foundations of the programming language and systems design, and these days the creator of the CLU programming language continues to work on issues. interesting.

We talked about innovation, abstraction and encapsulation in the 1970s and today in a recent chat.

Liskov, now 80, heads the Programming Methodology group at the Massachusetts Institute of Technology. Recently she worked on parallel computing and, together with a student, invented Byzantine fault tolerance * [PDF] in the 1990s, “which is very important to the blockchain world,” she says.

However, with CLU’s arrival on GitHub, attention turned to Liskov’s earlier work, with his students, in language creation in the early 1970s.

I think programming and software engineering is always an exciting career

“One of the interesting things about CLU,” she says, “was that due to the state of programming languages ​​at the time, there was a lot of innovation to get CLU off the ground.

“For example, we had to deal with the issue of generics, because before there was any notion of abstract data types, you actually already needed generics. If you were writing a sorting routine, you didn’t want to rewrite it every time you had a different kind of array, but people hadn’t really coped with that yet.

“And as soon as you have abstract data types, it becomes absolutely clear that you need generics,” she says. “So we had to figure out what to do about the generics, and that was a big deal.”

And then there was the exception handling, which tended to be a bit primitive at the time. Liskov recalls the debate over what was called the recovery model versus alternatives: “The question was, after the exception was thrown, did control revert to the code that triggered the exception, or did he just terminate this code? And so we had to face it. “

“If you don’t have a way to handle error cases separately from the main stream, then unfortunately what still happens today is that there are a lot of errors in the code that appear. often far from the source of the error. So the harder it is to find. “

In addition to error handling, other innovations in iterators were presented. “One of the things that meant was that we were sort of ahead of time,” Liskov continues, “because we were working on things that people hadn’t really faced yet.”

“Data abstraction is a big deal,” she says, “but all of these other things come with it. “

“If you look at, for example, what happened to Java in the 90s with the way they did parametric polymorphism, which it didn’t,” Liskov laughs, “you can also see with the management exceptions, people really never quite their act together. “

What happened to Java in the 90s with the way they did parametric polymorphism … is that they didn’t. You can also see that with exception handling, people never really got along

Of course, Liskov and his co-creators had the luxury that CLU was a research project and therefore not subject to the demands of several groups. However, in the late 1970s a crossroads was reached: try marketing the language or stick to research. Liskov opted for research. “None of the students in my group,” she said, “wanted to do a startup.”

Noting the difference with today’s experience, where launching something online and building a community around it is a relatively simpler process, she says things were quite different in the late 1970s. had to go through a company, she explains. “If I had had a few students who wanted to do this… but even then it was hard to get start-up money. It was a very different time than the early 90s.”

Then again, the nature of the CLU is that it hasn’t collected the grime that has plagued so many other languages ​​over the years. “Every time a language starts up,” Liskov says, “it starts to develop its heritage. And then you have this problem that you have to keep taking over all the code that has been written and that creates baggage.”

Most of the development work over the past 20 years that Liskov has been involved in has been in C ++. “There’s not a lot of development in machine language programming anymore. And that’s a big improvement, ”she says,“ you just need to raise that level of abstraction. And I think the principles of modularity are fairly well understood. “

However, “One of the things that I regret or wish were different is that I wish languages ​​would force encapsulation.”

“It’s true,” she concedes, “that sometimes you have to violate the encapsulation. And that’s usually when you’re building a low-level rig.”

However, Liskov argues that encapsulation – the grouping of data, along with the methods that work on that data, into a single unit – is a key part of the programming methodology: “the one that makes modularity work.”

“The best thing you can do academically is add it and tell students about its importance. But that’s not the same as asking a compiler to apply it.”

Still, other things have improved. Today’s cavernous storage capacities (at least compared to what was available in the 1970s) mean that compactness can give way to elegance when designing modules: “Yes, if you will. that it be usable on the one hand, but as simple as possible on the other. “

Liskov would like to thank her students Russ Atkinson, Alan Snyder and Craig Schaffert as well as Stephen Zilles, who was also at MIT and worked with her in 1973 to refine the concepts behind CLU.

Bob Scheifler, Eliot Moss, and Toby Bloom are also listed in the October 1979 CLU Reference Manual (PDF). Paper, History of CLU [PDF], gives a more detailed list of credits.

Liskov – who is also responsible for the Liskov Substitution Principle ** – continues to be passionate about programming and technology, and tells us, “I think programming and software engineering is still an exciting career.

“I think the distinction between interface and implementation is really good to keep in mind, you know… getting behavior defined separately from the implementation.

“And if you’re not in a language that enforces encapsulation, which unfortunately is most of them, then you have to enforce it on yourself.” ®

* One of the consensus mechanisms that helps maintain the integrity of the blockchain system

** Basically, that “objects from a superclass must be replaceable by objects from its subclasses without breaking the application”

Source link

]]>
https://brainethics.org/2021/09/16/turing-award-winner-barbara-liskov-on-clu-and-why-programming-is-always-cool-the-register/feed/ 0
Apple Watch Series 7 has an onscreen keyboard similar to FlickType https://brainethics.org/2021/09/14/apple-watch-series-7-has-an-onscreen-keyboard-similar-to-flicktype/ https://brainethics.org/2021/09/14/apple-watch-series-7-has-an-onscreen-keyboard-similar-to-flicktype/#respond Tue, 14 Sep 2021 22:53:00 +0000 https://brainethics.org/2021/09/14/apple-watch-series-7-has-an-onscreen-keyboard-similar-to-flicktype/

The new Apple Watch Series 7 launched today and these new smartwatches come with several significant improvements over the previous models. From a bigger screen to updated hardware and even new software features, the Watch Series 7 are the best Apple Watches yet. The new Apple Watch Series 7 also runs the latest version of watchOS out of the box – watchOS 8. Along with the new version and a larger screen, Apple has created a new QWERTY keyboard for the watch called QuickPath, which allows typing for reply to messages.

While a keyboard app is nice to have, it isn’t innovative and certainly isn’t original. In fact, Apple is accused of cloning another keyboard app for the Apple Watch called FlickType. Its founder, Kosta Eleftheriou, filed a lawsuit against Apple earlier this year after the company withdrew the iPhone version of the app. Eleftheriou took to Twitter following the Apple Watch Series 7 announcement, where he shared the email the App Store review team sent after removing the application earlier this year. The email says his app violated the Apple iOS Human Interface Guidelines section of the App Store Review Guidelines. It also states that “the application is a keyboard for Apple Watch. For this reason, your app will be withdrawn from sale on the App Store at that time.

For the uninitiated: FlickType is an accessibility keyboard for visually impaired users and can help people who are blind or visually impaired to type on an iPhone. The app was originally launched in 2018 and was followed in 2020 by a companion Apple Watch app that allows users to tap on their smartwatch to respond to notifications. When the related Apple Watch app was released, it hit the top spot for paid apps on the App Store for a while.

When Eleftheriou sued Apple earlier this year for removing the FlickType iPhone app, he alleged that Apple attempted to acquire the app from him and that Apple allowed competing apps to unfairly target him in order to devalue FlickType. . He said that when he complained about bogus reviews and ads, Apple didn’t do enough to tackle the apps he claimed were behind them.

After months of calls, Eleftheriou was able to get FlickType back from the App Store, even though he says he lost a year of revenue thanks to the length of time it was retired. Apple then banned its application again So last month, the developer decided to stop the development of the iPhone keyboard part of the app rather than continue to fight against Apple. Apple’s reasoning behind the removal was that the app needed “full access” to the network to function, alongside other iOS features, which is not allowed. Eleftheriou says that if the company had tried the app or looked at her previous conversations, they would have seen that the keyboard worked fine without network access.

“Our history of releases already spans over FOUR pages filled with repeated, unwarranted and unreasonable releases that serve to frustrate and delay rather than benefit end users. And dealing with App Review isn’t just time consuming. It’s also very exhausting emotionally ”, Eleftheriou wrote on Twitter.

Eleftheriou charged Apple with false advertising, unfair competition in violation of the California Business and Professional Code, breach of good faith and fairness with respect to the Apple Developer Program license agreement, fraud, negligence and negligent misrepresentation. As with any dispute between a developer and an app store, it’s not easy to tell who is right and who is wrong since we don’t have the big picture. However, it certainly doesn’t look good for Apple to launch an app that looks a lot like the one the developer has had issues with often.


Source link

]]>
https://brainethics.org/2021/09/14/apple-watch-series-7-has-an-onscreen-keyboard-similar-to-flicktype/feed/ 0
The fig tree is talking about them among gardeners in Gering as the fruits ripen https://brainethics.org/2021/09/11/the-fig-tree-is-talking-about-them-among-gardeners-in-gering-as-the-fruits-ripen/ https://brainethics.org/2021/09/11/the-fig-tree-is-talking-about-them-among-gardeners-in-gering-as-the-fruits-ripen/#respond Sat, 11 Sep 2021 05:06:20 +0000 https://brainethics.org/2021/09/11/the-fig-tree-is-talking-about-them-among-gardeners-in-gering-as-the-fruits-ripen/ GERING, Neb. (AP) – A nearly half-century old tree native to the Mediterranean and West Asia resides in a local greenhouse in the Panhandle. It remains the talk of the town almost every summer as its fruit ripens for harvest.

Growing up with the tree, many residents of Gering consider the fig tree at the Ever Green Community Greenhouse to be a staple food for the garden and the community.

“A lot of people are still interested in our big old fig tree,” said Carol Knaub, the master gardener who has run the greenhouse for almost seven years.

She told the Scottsbluff Star-Herald that the tree originated in Gering in the 1980s from the fig tree at Cheyenne Botanical Gardens. Since then, the little start has grown into a two-story tree that tries to grow through the greenhouse ceiling every year.

“In January, the city comes in and prunes everything for me,” Knaub said. “They prune it every year because the branches penetrate the ceiling in the glazing on the south side. So we have to reduce it or it will go through.


The tree hasn’t always seen prosperous days, however. Just a few years ago, aphids took hold of the tree and took the entire crop, Knaub said. Since she doesn’t use chemicals in the greenhouse for any of the plants, it took a lot of work to rid the tree of aphids and whiteflies, using only neem oil and a little soapy water.

“I had to bathe this tree twice a week,” she said. “I was spraying from the bottom, then I had to go up the stairs and spray down. … It was quite a chore but hopefully we’ll just keep going and keep these little baddies out of here.

After aphids took over the entire fig crop two years ago, the tree was able to produce a few figs last year. Knaub said this year has been even better.

In fact, Knaub recently harvested over 4 pounds of figs, which she sold for $ 5 a pound. She said the fig harvest helps fund the greenhouse for things like seeds, soil, and its non-profit status.

“The product of that, again, the money just goes into the greenhouse,” she said. “… We are all volunteers here. “

Knaub said she assumed the tree would continue to “stir” until October. After that, the tree loses its leaves until it leaves again around March.

With the tree as old as it is, however, Knaub said she wanted to start taking steps to preserve it for years to come – in the form of its cloning.

“We’re going to try to layer it on the air, that way it’s the exact tree, it’s just a new start,” she said.

Air layering is an asexual process that clones a plant by transferring the exact same genetic material through a newly rooted stem, which can then be cut from the parent plant to become a separate plant, but still the same.

While some fig trees have been recorded to live up to 200 years, Knaub wants to take the appropriate steps to maintain the tree – whether it’s the 42-year-old giant tree that still commands the entire greenhouse, or a new miniature copy. who keeps his legacy alive.

Knaub plans to harvest more figs on Thursday, September 9 and will sell them that morning. All profits will be used for the maintenance of the greenhouse.

Source link

]]>
https://brainethics.org/2021/09/11/the-fig-tree-is-talking-about-them-among-gardeners-in-gering-as-the-fruits-ripen/feed/ 0
Most Anticipated Sci-Fi & Fantasy Books of September 2021 According to Goodreads Members – GeekTyrant https://brainethics.org/2021/09/03/most-anticipated-sci-fi-fantasy-books-of-september-2021-according-to-goodreads-members-geektyrant/ https://brainethics.org/2021/09/03/most-anticipated-sci-fi-fantasy-books-of-september-2021-according-to-goodreads-members-geektyrant/#respond Fri, 03 Sep 2021 21:00:00 +0000 https://brainethics.org/2021/09/03/most-anticipated-sci-fi-fantasy-books-of-september-2021-according-to-goodreads-members-geektyrant/

Goodreads has revealed its list of the most anticipated sci-fi and fantasy novels for September according to its members. The list only covers 10 titles, so be sure to share your most anticipated books of the month in the comments section.

When a Reaper comes to pick up Wallace Price at his own funeral, Wallace suspects he might really be dead.

Instead of leading him directly into the afterlife, the Reaper takes him to a small village. On the outskirts, off the path through the woods, nestled between the mountains, is a peculiar tearoom, run by a man named Hugo. Hugo is the owner of the tearoom for the locals and the ferryman for the souls who need to cross.

But Wallace isn’t ready to give up the life he’s barely lived. With Hugo’s help, he finally begins to learn all the things he lacked in life.

When the Headmaster, a curious and powerful being, arrives at the tearoom and gives Wallace a week to walk through, Wallace sets out to live his life in seven days.

Shizuka Satomi has made a deal with the devil: to escape damnation, she must incite seven other violin prodigies to trade their souls for success. She has already delivered six.

When Katrina Nguyen, a young transgender girl on the run, catches Shizuka’s ear with her savage talent, Shizuka can almost feel the curse lift. She found her last candidate.

But in a donut shop on the edge of a busy San Gabriel Valley highway, Shizuka meets Lan Tran, a retired captain, interstellar refugee and mother of four. Shizuka doesn’t have time for crushes or dates with her coffee, with her soul on the line, but Lan’s kind smile and starry eyes might well redefine a soul’s worth. And maybe something as small as a hot donut is powerful enough to break a curse as vast as the California coast.

As the lives of these three women are entangled by chance and fate, a story of magic, identity, curses and hope begins, and a worthy family to cross the universe is found.

At Scholomance, El, Orion, and the other students face their final year – and the looming specter of graduation, a deadly ritual that leaves few students alive in its wake. El is determined that her chosen group will survive, but it’s a prospect that grows more complicated by the day as the school’s savagery escalates. Until El realizes that sometimes winning the game means beating all the rules …

One morning in October, Laina learns that her brother has been shot by cops in Boston. But what looks like a case of police brutality soon reveals something far stranger. Monsters are real. And they want everyone to know that.

As creatures of myth and legend emerge from the shadows, seeking safety through visibility, their emergence sets off a seemingly unrelated chain of events. Members of a local werewolf pack are threatened with silence. A professor follows a missing friend’s breadcrumb trail to a mysterious secret society. And a young boy with unique abilities seeks refuge in a pro-monster organization with his own secrets. Meanwhile, more and more people are starting to disappear, suicides and hate crimes are on the rise, and protests are breaking out globally, both for and against the monsters.

At the center is a mystery that no one thinks of asking: why now? What scared the monsters of the dark?

The world will soon find out.

Chaos. Fury. Destruction.

The Great Change is upon us …

Some say that in order to change the world, you must first burn it down. Now that belief will be put to the test in the crucible of revolution: The Breakers and Burners have seized the levers of power, the smoke of the riots has replaced the smog of industry, and all must submit to the wisdom of the crowds.

With nothing more to lose, Citizen Brock is determined to become a new hero for the new era, while Citizeness Savine must transform his talents from profit to survival before he can make his way to redemption. Orso will discover that when the world is turned upside down, no one is less than a monarch. And in the bloody North, Rikke and his fragile protectorate are running out of allies. . . while Black Calder gathers his forces and prepares his revenge.

The shores have fallen, the Union sun has set in, and in the darkness of the wings, the threads of the Weaver’s ruthless plan are slowly being tied …

The Montoya are used to a life without explanations. They know better than to ask why the pantry never seems to be short or empty, or why their matriarch will never leave their home in Four Rivers, even for graduation ceremonies, weddings, or christenings. But when Orquídea Divina invites them to her funeral and to reclaim their inheritance, they hope to uncover the secrets she has kept so closely all their lives. Instead, Orquídea is transformed, leaving them more questions than answers.

Seven years later, his gifts manifested themselves in different ways for Marimar, Rey, and Tatinelly’s daughter, Rhiannon, granting them unexpected blessings. But soon, a hidden figure begins to tear apart their family tree, taking them out one by one as she seeks to destroy the Orquídea line. Determined to save what remains of their family and uncover the truth behind their legacy, the four descendants travel to Ecuador, to the place where Orquídea buried her secrets and broken promises and has never looked back.

Dark Matter meets Annihilation in this mind-boggling and emotional speculative thriller set in a world where the exact moment of your death can be predicted, for a price.

Our narrator is the most talented salesperson at Dare to Know, a prestigious and enigmatic death prediction company. While he has mastered the art of death, the rest of his life is a miserable failure. Divorced, separated from his sons and broke, he is driven to violate the cardinal rule of his business by predicting his own day of death. The problem: apparently he died 23 minutes ago.

The only person who can confirm his prediction is Julia, the woman he loved and lost on his rise through the ranks of Dare to Know. As he travels the country to see her, our narrator is forced to confront his past, the choices he made, and the terrifying truth about the company he works for – and his role there.

Highly ambitious and utterly immersive, this adrenaline-fueled thriller explores the destructive power of knowledge and blows the lines between reality, myth and conspiracy as it rushes to its astonishing conclusion.

A diverse team of broken and diminished former criminals come together to solve the mystery of their last disastrous mission and to save a missing and much changed comrade … but they’re not the only ones pursuing the secret deep in the planet Dimmuborgir. . The universe’s highly evolved AI has its own agenda and will do whatever it takes to prevent humans from once again controlling the universe. This group of dangerous women, half-clone and half-machine, must fight their own traumas and a universe of wise ages who want their deaths, in order to settle their affairs once and for all.

The Actual Star takes readers on a journey spanning thousands of years and across six continents – collapsing three separate timelines in a cave in the Belizean jungle.

An epic saga of three reincarnated souls, this novel demonstrates the entanglements of tradition and progress, of sister and stranger, of love and hate. The book moves back and forth in time among a pair of twins who ruled a Mayan kingdom, a young American on a journey of self-discovery, and two dangerous charismatics in a conflict that will determine the fate of the few humans left on Earth after massive climate change. .

In each era, age-old questions about existence, belonging and identity converge deep underground. Because only in total darkness can you really see the stars.

In the near future, advances in medicine and quantum computing will make human cloning a reality. For the rich, cheating on death is the ultimate luxury. For anti-cloning activists, this is an unnatural abomination. For young Constance “Con” D’Arcy, who received her own clone from her late aunt, it’s terrifying.

After a routine monthly upload of his consciousness – stored for this inevitable transition – something is wrong. When Con wakes up in the clinic, it’s eighteen months later. Her recent memories are gone. His original, he is told, is dead. If that’s true, what does that make her?

The secrets of Con’s disorienting new life are buried deep. So are those of how and why she died. To uncover the truth, Con retraces the last days she remembers, crossing paths with an equally curious detective. On the run, she needs someone she can trust. Because only one thing has become clear: Con is marked for murder, once again.

Source link

]]>
https://brainethics.org/2021/09/03/most-anticipated-sci-fi-fantasy-books-of-september-2021-according-to-goodreads-members-geektyrant/feed/ 0
Harbor BioMed Announces IND Approval for Phase II Trial of Anti-FcRn Batoclimab in Chronic Inflammatory Demyelinating Polyneuropathy in China https://brainethics.org/2021/09/01/harbor-biomed-announces-ind-approval-for-phase-ii-trial-of-anti-fcrn-batoclimab-in-chronic-inflammatory-demyelinating-polyneuropathy-in-china/ https://brainethics.org/2021/09/01/harbor-biomed-announces-ind-approval-for-phase-ii-trial-of-anti-fcrn-batoclimab-in-chronic-inflammatory-demyelinating-polyneuropathy-in-china/#respond Wed, 01 Sep 2021 05:05:00 +0000 https://brainethics.org/2021/09/01/harbor-biomed-announces-ind-approval-for-phase-ii-trial-of-anti-fcrn-batoclimab-in-chronic-inflammatory-demyelinating-polyneuropathy-in-china/

CAMBRIDGE, Mass. and ROTTERDAM, Netherlands and SUZHOU, China, Sept. 1, 2021 / PRNewswire / – Harbor BioMed (“HBM”, HKEX: 02142) today announced that the Center for Drug Evaluation (CDE) of the China National Medical Products Administration (NMPA) has approved the new investigational drug (IND) request to initiate a phase II trial of anti-FcRn batoclimab in patients with chronic inflammatory demyelinating polyneuropathy (CIDP).

HBM is developing batoclimab (HBM9161) as a product pipeline to treat multiple pathogenic IgG-mediated autoimmune diseases with significant unmet medical needs.

Based on the new batoclimab mechanism and on high unmet medical needs in China, HBM has initiated clinical trials in several autoimmune diseases with reported positive results, including myasthenia gravis, Grave’s ophthalmopathy, adult immune thrombocytopenia (ITP) and neuromyelitis optic spectrum disorder (NMOSD).

CIDP is a chronic, progressive disease characterized by progressive weakness and impaired sensory function of the legs and arms and is closely related to Guillain-Barré syndrome. Pulsed corticosteroids and intravenous immunoglobulin (IVIg) are common therapies for patients with CIDP, but they can hardly meet the increasing medical needs of patients in terms of side effects and drug availability.

“Due to the side effects of steroids and limited access to IVIG, there are still many unmet medical needs to explore new effective and practical therapies for CIDP. We believe that this new mechanism will provide safe and effective therapy for patients with CIDP. We are committed to further accelerating this exciting new therapeutic development to help Chinese patients by need,” said dr. Jingsong Wang, Founder, CEO of Harbor BioMed.

About the Batoclimab (HBM9161)

Batoclimab (HBM9161), a fully human anti-FcRn mAb, blocks FcRn-IgG interactions, accelerating the degradation of autoantibodies and leads to the treatment of pathogenic autoimmune diseases mediated by IgG. A phase 2 study in myasthenia gravis showed that batoclimab can quickly and significantly relieve symptoms in patients and improve quality of life. Previous studies have demonstrated that batoclimab is well tolerated and can rapidly reduce total IgGs in a wide range of pathogenic IgG-mediated autoimmune diseases. HBM licensed batoclimab (HBM9161) from HanAll Biopharma and has the right to develop, manufacture and market in Greater China (including Hong Kong, Macau and Taiwan).

About Chronic Inflammatory Demyelinating Polyneuropathy (CIDP)

CIDP is a chronic, progressive disease characterized by progressive weakness and impaired sensory function of the legs and arms and is closely related to Guillain-Barré syndrome. Corticosteroid pulses after high-dose maintenance of prednisone or intravenous immunoglobulin (IVIG) are common therapies for patients with CIDP, with about two-thirds of patients requiring IVIG for many years. Due to the side effects of steroids and limited access to IVIG, there are still many unmet medical needs to explore new effective and practical therapies for CIDP.

About Harbor BioMed

Harbor BioMed (HKEX: 02142) is a global biopharmaceutical company engaged in the discovery, development and commercialization of novel therapeutic antibodies focused on immunology and oncology. The Company builds its solid portfolio and differentiated pipeline through internal R&D capabilities, collaborations with co-discovery and co-development partners and selected acquisitions.

Harbor Mice’s proprietary antibody technology platforms® generate fully human monoclonal antibodies in two heavy chain and two light chain format (H2L2), as well as heavy chain only format (HCAb). Based on anti-HCAb antibodies, HCAb-based immune cell activators (HBICE ™) are capable of producing tumor-killing effects not achievable by traditional combination therapies. Integration of house mice® With a single B cell cloning platform, our antibody discovery engine is very unique and efficient for the development of next generation therapeutic antibodies.

For more information, please visit www.harbourbiomed.com

SOURCE Port BioMed

Source link

]]>
https://brainethics.org/2021/09/01/harbor-biomed-announces-ind-approval-for-phase-ii-trial-of-anti-fcrn-batoclimab-in-chronic-inflammatory-demyelinating-polyneuropathy-in-china/feed/ 0
Lower Decks is reminiscent of Spock 2 from the animated series https://brainethics.org/2021/08/23/lower-decks-is-reminiscent-of-spock-2-from-the-animated-series/ https://brainethics.org/2021/08/23/lower-decks-is-reminiscent-of-spock-2-from-the-animated-series/#respond Mon, 23 Aug 2021 23:45:00 +0000 https://brainethics.org/2021/08/23/lower-decks-is-reminiscent-of-spock-2-from-the-animated-series/

A giant skeleton in a Starfleet uniform plays a huge role in the latest episode of Star Trek: Lower Decks while also nodding to the animated series.

WARNING: The following contains spoilers for Star Trek: Lower Decks Season 2, Episode 2, “Kayshon, His Eyes Open,” streaming now on Paramount +.

Star Trek: Lower Bridges has an open affection for Star Trek: The Animated Series. Its only precursor in the animation wing of the franchise has long remained an outlier, due to its relative obscurity and, at times, its bizarre premise. But it remains canon – despite the dismay of fans who find his Saturday morning concepts beneath the dignity of Star Trek – and its confluence of elements becomes too much of an easy target for Lower decks stay away.


Season 2, Episode 2, “Kayshon, His Eyes Open,” centers its climax around an Easter egg from The animated series. The giant skeleton behind which the crew takes shelter during the episode’s big battle is reminiscent of The animated series Season 1, Episode 7, “The Infinite Vulcan”. It’s a smart choice, not only for the ridiculousness of the thing, but also for the way it relates. The animated series to the cannon whether fans like it or not.

RELATED: Star Trek: Lower Decks Honors Picard’s Most Loved Ally – Metaphorically Speaking

The animated series“The Infinite Vulcan” involves a planet whose plant life forms serve a gigantic human named Stavos Keniclius 5: the clone of an infamous participant in the Eugenic Wars who used his cloning techniques to create new versions of himself – even to continue his work. When the Enterprise visits him, he determines that Spock is the “perfect specimen” for his job. After kidnapping the Vulcan, he creates a giant clone of Spock to serve as a precursor to a “peacekeeping” army of similar creatures.

Like many episodes of The animated series, the concept came up as a cost saving option. A giant Spock as a potential enemy meant animators didn’t have to design and design a new character. But beyond that, the episode looks a lot like Star Trek. His main dilemma cannot be simply solved by phasers – Kirk and the crew develop a “weedkiller” to combat their plant-like enemies – and the situation is ultimately resolved without violence.

“Spock 2”, as the giant clone is called, possesses all the wisdom and benevolence of the original model and thus stops the creation of the army simply by refusing to be part of it. Episode was written by Trek alum Walter Koenig, despite the fact that he was not part of the vocal cast, and Chekov never appeared in The animated series. It even includes references to well-established canonical events, such as the eugenic wars. Creatively it belongs inextricably to Star Trek, and like it or not, the overall silliness of Spock 2 accompanies this equation.

RELATED: Lower Bridges: Boimler Just Was A Victim In One Of Star Trek’s Oldest Tropes

Lower decks likes these details in part because it allows them to really laugh at the expense of the franchise without hurting its strengths. It undermines a lot of satire just by waving the things more serious fans would rather forget and reminding them that they are part of this universe as well. These callbacks don’t get any bigger than the still-in-uniform Spock 2 skeleton, which towers over a museum-like bone room on the collector’s ship. Mariner and the rest of the team take cover behind him as the ship’s security drones – which literally float Roombas – try to get them in.

The joke not only works by drawing on the absurdity of a giant Spock roaming the galaxy, but also using it as a real, practical solution to the episode’s main threat. The writers could have put a number of viable things the team could hide behind, and the rest of the episode wouldn’t change. The simple nod to a wacky visual is enough to make you laugh.

But he digs into another favorite too Lower decks target: Starfleet’s lack of follow-up. The original series and The Animated series were written with syndication in mind, which meant that each episode had to be stand-alone and interchangeable in the timeline. The long-term consequences of crew actions have never been explored – not before Star Trek II: The Wrath of Khan at the earliest – which meant wonders like Spock 2 were virtually ignored after the first encounter. Its presence of a collector’s vessel allows Lower decks target Starfleet’s lack of accountability in certain areas while letting Spock 2 contribute to the safety and well-being of its staff.

Star Trek: Lower Decks Season 2 airs now on Paramount +, with new episodes airing every Thursday.

KEEP READING: Star Trek: Lower Decks Season 2, Episode 2, “Kayshon Eyes Open” Recap & Spoilers

Reactions from He-Man and the Masters of the Universe to the reboot are overwhelmingly positive


About the Author

Source link

]]>
https://brainethics.org/2021/08/23/lower-decks-is-reminiscent-of-spock-2-from-the-animated-series/feed/ 0
5 Villains Who Belong To Ravencroft (And 5 Who Should Belong To The Raft) https://brainethics.org/2021/08/22/5-villains-who-belong-to-ravencroft-and-5-who-should-belong-to-the-raft/ https://brainethics.org/2021/08/22/5-villains-who-belong-to-ravencroft-and-5-who-should-belong-to-the-raft/#respond Sun, 22 Aug 2021 22:12:16 +0000 https://brainethics.org/2021/08/22/5-villains-who-belong-to-ravencroft-and-5-who-should-belong-to-the-raft/

Spider-Man is one of the greatest heroes in the Marvel Universe and a big reason is his villains. Spider-Man battles some of New York’s most dangerous villains, who are also some of Marvel’s most interesting foes. From whimsical villains of the Silver Age to the most realistic and brutal of modern times, Spider-Man’s enemies present difficult challenges for the hero.

RELATED: Marvel: Characters You Forgot Teamed Up With Spider-Man

An interesting facet of Spider-Man’s enemies is that while many of them are just criminals, some of them have underlying psychological issues that motivate their crimes. While some of Spider-Man’s enemies belong to The Raft supervillain prison, others are more suited to the Ravencroft Asylum, where they can get help.


ten Belongs to Ravencroft: Doctor Octopus’ inferiority complex could be improved in therapy

Doctor Octopus

Doctor Octopus is one of Spider-Man’s oldest enemies. He has also proven to be one of the Wall-Crawler’s greatest enemies, even becoming a superior Spider-Man. However, the accident that tied Ock’s arms confused his mind and even before that he had big inferiority issues. These two factors combined make him someone who needs help.

Ravencroft could show Ock how to deal with issues with his arms, which sometimes have their own unique personality, and his inferiority complex. He’s proven to be a great hero in the past and could be a great hero again if he gets the right help.

9 Belongs in the Raft: Kingpin’s Crimes And Reach Demands Hard Jail To Hold Him

Kingpin has long been one of New York’s most dangerous criminals, ruling a criminal empire that spans the world. He has no qualms about doing all the terrible things he needs to do and has been a thorn in the side of many heroes. Unlike other Spider-Man foes, Kingpin has no real excuses for his actions other than a lust for power and should be put on the raft.

Kingpin has a wide reach and whenever he is put in a regular jail he easily breaks free. The Raft is a harder nut to crack and it’s exactly the kind of place a criminal of Kingpin’s caliber belongs, a tough prison that can hold him like no other.

8 Belongs to Ravencroft: the lizard must learn to manage his handicap in a healthy way

Dr. Curt Connors had a laudable goal. He wanted to merge human and reptile DNA, so that humans could regrow severed limbs. He experimented on himself, trying to grow his severed arm back, but it led to him becoming the Lizard, one of Spider-Man’s most terrifying villains. He never learned to manage his disability well, seeing it as a problem to be solved, something that therapy would help him with.

RELATED: 8 Must Read Modern Spider-Man Comics

Maybe if Connors had handled his disability better, he wouldn’t have tried to rush things and failed to achieve his goal. A stay at Ravencroft might teach him how to deal with this and allow him to accept himself, perhaps even becoming a greater help to the world.

7 Belongs to the Raft: Rhino is a dangerous criminal with no apologies for his actions

Marvel Rhino Extreme Transformed Rampage

Rhino is one of Spider-Man’s most powerful enemies, able to even take on the Hulk and get a good idea. It’s extremely impressive, and it means the kind of destruction Rhino can cause is untold. Unlike many of Spider-Man’s enemies, he has no psychological reason for his crimes and must be placed in a location that can hold him back.

The Raft is made for supercriminals like the Rhino. Power inhibitors will prevent him from escaping or brutalizing others. Rhino is a dangerous person and should be placed in a location where he cannot hurt others.

6 Belonging to Ravencroft: the jackal has been mad for years

Miles Warren the Jackal

The Jackal is partly responsible for one of the darkest chapters in Spider-Man history: the Clone Saga. Creator of the Spider-Clone, he was also obsessed with his former student Gwen Stacy, whom he brought back to life through cloning. He would disappear for years until he returned during the Clone Saga, where he was portrayed as an almost Joker character.

Jackal’s years of experimenting with himself and others have driven him mad and his actions prove it. For this reason, he should be placed in Ravencroft where he can learn to deal with his problems in a more constructive manner.

5 Belongs to the Raft: Kraven the Hunter just wants to prove he’s better than Spider-Man

Kraven the hunter has grown into one of the greatest hunters in the world, hunting and killing some of the most dangerous beasts on the planet. He eventually decided that Spider-Man was the ultimate prey and pursued him for years, trying to defeat the hero to prove he was better than him. There really isn’t any psychological weakness involved in Kraven’s reasoning, he just enjoys what he does.

Kraven isn’t exactly the worst criminal in the world, but he’s still a criminal, and rather willful. Putting a dangerous man like him on the raft would be a fitting punishment, especially when one realizes that he was literally chasing a teenager for years.

4 Belongs to Ravencroft: Shriek’s mental issues have kept others using him for years

Shriek is Carnage’s girlfriend and just like him, she loves to wreak havoc and kill others. Shriek’s sonic powers make her very dangerous and it doesn’t help that she is unstable. This has allowed Carnage to use her in her own twisted serial killings and it’s something she needs help with.

RELATED: Marvel: The 10 Funniest Spider-Man Quotes In The Comics

Putting Shriek in a Raft prison wouldn’t do him any good. In Ravencroft, she can get the help she needs.

3 Belongs to the Raft: The vulture’s criminal life was driven by greed and revenge

The Vulture started his time as a criminal trying to make up for the loss of his small business due to the extortion of his partner. From there, he would run into Spider-Man and continue his criminal ways. He joined the Sinister Six in revenge on the Wall-Crawler and his actions prove that he must be put in jail.

The Raft is a tough place, but Vulture is a more dangerous criminal than his age would lead you to believe. Putting him on the raft is proper punishment for a man who has committed crimes for no other reason than greed and revenge.

2 Belongs to Ravencroft: Green Goblin’s existing struggles have been exacerbated by the Goblin Formula

Green goblin

The rivalry between Green Goblin and Spider-Man is legendary. Norman Osborn built an industrial empire and even before his stint as a criminal was a ruthless man. The Goblin Formula made matters worse, pushing him past the limit. Even when he was ostensibly better, during his time with the Thunderbolts and Dark Avengers, his character Green Goblin almost acted like an alternate personality.

Green Goblin has done a lot of bad things over the years, but his struggles are intense and putting him in jail would only make it worse. A long stay at Ravencroft might help him learn to manage things in a healthier way.

1 Belongs to the Raft: Carnage is a monstrous serial killer

carnage

When Carnage first appeared, he was sharing a prison cell with Venom. Cletus Kasady was a serial killer and gaining a symbiote only made it worse. He had become one of Spider-Man’s most terrifying enemies, going on a rampage and trying to kill as many people as possible. There is only one thing Carnage loves and that is killing.

A place like Ravencroft can’t help someone like Carnage. He’s killed way too many people and must be held in a place like the Raft. The Raft can take care of and hold him better than anywhere else.

NEXT: 10 DC Comics Every Spider-Man Fan Should Read

Bizzaro, Black Adam and Sinestro


Next
DC: 6 villains who would make great heroes


About the Author


Source link

]]>
https://brainethics.org/2021/08/22/5-villains-who-belong-to-ravencroft-and-5-who-should-belong-to-the-raft/feed/ 0