Brain Ethics http://brainethics.org/ Sat, 18 Sep 2021 09:09:07 +0000 en-US hourly 1 https://wordpress.org/?v=5.8 https://brainethics.org/wp-content/uploads/2021/05/brain-ethics-icon-150x150.png Brain Ethics http://brainethics.org/ 32 32 Presidency 2023: Danjuma, Yakasai, Sani fault of the governors of the South on the zoning | The Guardian Nigeria News https://brainethics.org/2021/09/18/presidency-2023-danjuma-yakasai-sani-fault-of-the-governors-of-the-south-on-the-zoning-the-guardian-nigeria-news/ https://brainethics.org/2021/09/18/presidency-2023-danjuma-yakasai-sani-fault-of-the-governors-of-the-south-on-the-zoning-the-guardian-nigeria-news/#respond Sat, 18 Sep 2021 04:15:00 +0000 https://brainethics.org/2021/09/18/presidency-2023-danjuma-yakasai-sani-fault-of-the-governors-of-the-south-on-the-zoning-the-guardian-nigeria-news/

[FILES] governors of the south

Angered by the Nigerian Southern Governors Forum’s insistence that the country’s next president should come from the south of the country, some northern leaders said nothing could prevent a Nigerian from running for the 2023 presidential election.

The governors of the south at their meeting in Enugu last Thursday reaffirmed the position they had taken at their meeting in Asaba, Delta State, earlier in the year.

But some Arewa leaders, who spoke to The Guardian about development, declared the move unconstitutional, saying Nigerians should not allow ethnic or regional considerations to determine who becomes president in the 2023 general election.

They argued that it was the adoption of these parochial parameters as a basis for selection in other areas of the country that delayed Nigeria’s progress.

Former Arewa Consultative Forum (ACF) General Secretary Elder Anthony Sani and Arewa Youth for Development and Progress (AYDP) National President Danjuma Sarki, who spoke in Kaduna, said that the call of the governors of the south should not be taken seriously by Nigerians if the country is to move forward after the general elections of 2023.

Speaking in an interview, Sani said, “The constitution allows any Nigerian to aspire to any office. So if southerners aspire to produce the president in 2023 democratically, that is their right as Nigerians. What the constitution did not provide is the rotation of the President of Nigeria by rotation between North and South.

According to the head of the ACF, “in order for the North and the South to come together and produce the president, the constitution provides that the candidate must not only garner majority votes, but must also obtain at least 25 percent of the votes in the country. at least two-thirds of the 36 states and FCT. And because no region has all 24 states, it becomes necessary for political parties and their presidential candidates to travel across the country, breaking down barriers and building bridges in the execution of their winning game plans.

Sani said that “in a way, correct practices of our multiparty democracy can go a long way in uniting the nation in peace and prosperity.”

He added: “The governors of the south are not justified in insisting on producing the president in an undemocratic manner. That is, if they want it to be done in an undemocratic way through affirmative action. But if they want it through our multiparty democracy as provided for in the constitution, then there is no qualms. Especially since under the nascent democracy, the South will have governed for 13 years and the North for 11 years by 2023.

“Either way, I think the president’s rotation and the zoning of public office is a tacit admission of leadership failure to provide fair, just and equitable access to national employment resources,” appointments, projects and major contracts to their constituencies.

“As a result, Nigerians are led to believe that such access to domestic resources should be a turn-based approach. And they long for the politics of identity with a gleeful disregard for the fact that there are multiple lines of demarcation of regions, religions, ethnicity, gender, and generation of young people and adults.

Sani continues: “We have seen such practices supplant the performance identity policy, which has no place at the polls. Note that Ethiopia, which has never been colonized, practices ethnic federalism and is still experiencing problems. Lebanon, which practices a policy of religious divisions with a Christian president, a Sunni prime minister and a Shiite speaker, is never without challenges.

He added: “Nigeria faces challenges that naturally accompany the nation-building process that is underway.

But difficult times should bring national greatness, determined leadership and the best in everyone, and not stir up divisions by promoting the nation’s cleavages along ethnic, religious and regional lines.

“We had better come together and unleash our potential for synergy against collective challenges for the good of all. Our situation is never beyond redemption.

Speaking in a similar vein, AYDP National President Sarki Danjuma said the governors in the south were fighting for their personal interests.

“The resolve of the governors of the South can be seen in the light of the struggle against a regional cause, but I want to tell you that there is no other interest opposed by the governors of the South apart from the personal interest.

“We know there are a lot of these southern governors who want to aspire to the presidency. Governor Umahi has never hidden his interest in aspiring to the presidency of Nigeria. We also have in the PDP someone like Governor Wike. If we look at issues critically, southern governors do not aspire to a southern presidency based on objectivity or rational reasoning; it is loaded with certain selfish interests, ”he said.

Danjuma said that, “given the state of the nation today and how the Buhari administration has beaten Nigeria and pushed us back, I think the current turmoil for the regional presidency is not is not the best idea “.

He added, “For people to limit Nigeria’s presidency to a particular area will not bode well for our country. In fact, we currently need a leader in 2023 who is truly a nationalist who is patriotic and who is able to reposition the country. If we limit the choice of the presidency to one region, it is as if we are going to put the Nigerians in a cage and resist their choice.

For his part, an elderly statesman and founding member of the ACF, Alhaji Tanko Yakasai, who spoke in Kano, advised southern governors to employ persuasion in their quest.

Yakasai noted that neither of the country’s two main parties could decide which zone would produce Nigeria’s next president, adding that it was a matter of numbers and persuasion.

He said he has since put all his weight into the quest for the Southern presidency in 2023, but frowned on the path and the way the governors went about it.

“You don’t have common ground on something that isn’t quite your own birthright. You have to resort to broader consultation with other stakeholders to get what you want.

“It is impossible for a group to decide that the presidency should come to an area; it is a question of size, number and understanding. I have seen some governors decide for APC, but I don’t know what their reasons are, ”he added.

Yakasai insisted that in a multi-party democracy, supporters of one or two parties could not dictate who the next president would be.

Another prominent politician in Kano, Alhaji Haruna Musa Fatahi, also called the demand for the presidency to be zoned in the South undemocratic.

Two-time House of Representatives Fatahi insisted the majority should win the vote.

He argued that in a democratic dispensation, “you are not imposing any presidential candidate on anyone.”

“It is against the principles of democracy,” he noted.

He added that zoning is neither in the Nigerian constitution nor in the constitutions of the APC or the PDP, stressing that politics is a numbers game.

Source link

]]>
https://brainethics.org/2021/09/18/presidency-2023-danjuma-yakasai-sani-fault-of-the-governors-of-the-south-on-the-zoning-the-guardian-nigeria-news/feed/ 0
“My mother died by euthanasia. For my family, this day is a positive memory ‘ https://brainethics.org/2021/09/18/my-mother-died-by-euthanasia-for-my-family-this-day-is-a-positive-memory/ https://brainethics.org/2021/09/18/my-mother-died-by-euthanasia-for-my-family-this-day-is-a-positive-memory/#respond Sat, 18 Sep 2021 01:30:00 +0000 https://brainethics.org/2021/09/18/my-mother-died-by-euthanasia-for-my-family-this-day-is-a-positive-memory/

My parents were both very supportive of euthanasia. They have a strong urge to end your life when you feel it no longer meets your own standards. They made this known in 2014, when they were both in good health and in their sixties, by signing a declaration of euthanasia with their general practitioner. They agreed that euthanasia was an option in cases of intolerable suffering, terminal illness and dementia.

It was in the Netherlands, where euthanasia has been legalized for capable adults and emancipated minors since 2002. It is the same in Belgium, where I grew up, where I met my Irish husband and where are born our children. Each year, less than 5% of deaths in these countries are due to euthanasia, and 85% of them are patients with terminal illness. General practitioners are actively involved.

In 2018 my mother was diagnosed with bowel cancer and received excellent care. The surgery to remove part of the intestine was successful and she started chemotherapy. Six weeks later, she developed pain radiating to her spine that prevented her from sleeping. It took some time to get a final diagnosis. At first, it was thought that this pain was due to the operation and not the cancer. After weeks of uncontrollable pain, however, it became increasingly evident that the cancer had spread throughout her body. In early 2019, he was told that the treatment could only be palliative. It started with morphine patches.

This news was a blow, for her and for my father in particular, but also for my brothers and sisters, whose lives have changed dramatically. My two sisters are registered nurses and lived near my parents. They decided to take care of her. From that point on, my mom became a full-time patient, with my dad and sisters providing round-the-clock care so that she could stay at home. Living in Ireland I have only observed this from afar, with infrequent visits and regular phone calls.

My mother’s health gradually deteriorated. Yet on another level, she had the time of her life. She always liked to be the center of attention. It was something she had wanted since she was sent to boarding school at the age of eight, a traumatic experience. Her cancer, strangely enough, gave her a shameless approach to getting that attention, both from my father and my sisters.

My brother took care of all the practical arrangements. He also showered her with flowers. The house was always full of them – and she loved it. Yes, my mother, battling cancer, certainly got the most of the attention, and she loved every moment of it.

In June, the pain started to take hold of her and the morphine patches could no longer control the pain. She was provided with a morphine pump and the dose was slowly increased each week. Her belly began to show cancer growth. Although other parts of her body lost weight, her stomach swelled.

Throughout her medical journey, her general practitioner was very close and guided her every step of the way. He contacted her weekly in person and whenever necessary by phone. She loved him very much and that helped her to be very young. She liked it. But at the end of July, her conversations with him changed from “What can we do next?” To “it’s getting too serious”.

They talked about passive euthanasia, which would mean increasing her medication, stopping her food and water intake, and inducing a coma so that she died peacefully. Considering the amount of water retention in her tummy, however, it could take weeks, if not longer, and was rejected. Passive euthanasia would lead to secondary ailments, such as bedsores, and the care required – without her being mentally present – would weigh heavily on her whole family. Her condition was bad and my sisters and my father were tired. A decision was made to hire a night nurse, so that everyone could at least get a good night’s sleep.

A few days later, my mother summoned the general practitioner. After talking to her, he called a meeting. My mom wanted to start the conversation about active euthanasia. She was on the maximum dose of morphine, her pain was increasing all the time, and relief was only occasional. She was in real pain. It was decided to initiate the process of active euthanasia.

His declaration was in place with the general practitioner, but to proceed with euthanasia, an independent SCEN doctor (accompaniment and consultation of euthanasia) must meet with the patient to confirm his will. These doctors have been trained in the legal aspects of euthanasia, to support general practitioners and provide independent observation of the patient’s wish to die.

My father called me on a Friday afternoon, a call that I had been waiting for a long time but which caught me off guard at the same time. He told me that they had decided to start the procedure and asked me if I still supported this decision. Even if it is not the family’s decision and they cannot override or change the patient’s wishes, it is important to have their support.

As in many families, we often have different opinions, but in this we all recognized my mother’s wish and supported her. My dad called back on Saturday and told me the SCEN doctor would come on Monday. He was worried because my mother was taking such a high dose of morphine that it was difficult to counteract it with another drug, Haldol, to keep her present. He feared that she might not be able to tell her story coherently, thus stopping the process. You had to trust the process, and the doctor SCEN, who would have seen many patients in his condition. I booked my flight.

Monday has come. I left Galway on the airport bus while the SCEN doctor sat with my mother for over two hours. She left without speaking to the rest of the family. The general practitioner confirmed the next day that the SCEN doctor had approved active euthanasia. My mother asked for a priest. The general practitioner ordered the medicine. The day and time have been set: Wednesday at 1 p.m.

It was decided that only her children and my father would be informed of the timing. We agreed that his grandchildren, his sisters and brothers, all the other families, would not be informed until afterwards. My mom had spent the last few months saying goodbye to everyone, and she had had enough. We needed our energy and attention to sustain her and we are grateful for this decision: no distractions.

The GP returned on Tuesday and had a brief conversation with my mother, once again confirming his wishes. My dad wanted to be alone with her that night and it was decided that we would meet again at 10am the next day. Each of us had a task. My older sister was taking care of the medication. She spoke to the nurses who maintain the morphine pumps, about how to keep my mom present without panicking. She got it right. My younger sister would dress her. I had to wash her and prepare food. My brother got the flowers.

Wednesday morning. My mother was surprisingly calm and happy. My father was trying very hard to stay the course. He made a rule. The room in which my mother’s bed was placed was going to be a “dry room”. What he meant, you’re crying out there; once inside, you are there to support your mother. Fair enough. He also wanted to have coffee and a piece of cake at 11am, after which they would go to my mom’s room and set him up. We then had to join them. The plan was established.

The job is done, 11am came, coffee and cakes were served. Only my mother ate the cake. Her cancer had kept her appetite roaring all along and now was no different. She even completed some of the other installments, commenting on how good it was. We must have laughed.

So my dad stood up and said, “It’s about time. It was an intense moment, fighting against tears; memory still brings them even now. We found ourselves sitting with the leftover cake, a little stunned. Half an hour later, we were called into the “dry room”. By then we were all settled. The atmosphere was positive. We checked with each other, with my dad, and then for the last time, with my mom. Mom, are you sure? She was calm and together, holding my father’s hand. Yes, she was sure of it.

Sometimes situations just throw you away. The GP and his colleague, in the Dutch manner, got on their bikes and locked them. The bike lock hit me with a surreal feeling; it was such an ordinary thing to do in such extraordinary circumstances.

It was a beautiful sunny day. They came in and we were asked to leave the room. The GP was alone with my mom, briefly, I guess to confirm with her again, to be sure. He called us back and started to settle down. My father took a seat on the bed, holding my mother in his arms. My older sister was holding it. My brother and younger sister were on the other side of the bed, holding her hand. I was at his feet. Earlier today, the nurse inserted a port. Everything was ready.

Then the GP broke down. It was his first euthanasia, which is why his colleague was with him to support him. My mom got the nicest response – it’s amazing what these situations bring – and she told him to take her time, that she really enjoyed all of her time with him and that she was ready when he did. was. He apologized, but we all laughed and asked my dad, “So this dry room thing doesn’t apply to him?” My father smiled and shrugged. The GP has regained control of his emotions. We all said a final goodbye and my mom confirmed for the last time. He first gave her something to put her to sleep. Her head fell against my father’s arm and she gave a last loud snore. He then administered the drug to stop his heart. At 1:03 p.m., she was gone; we closed our eyes.

The GP left for a moment and we slowly took in the situation. He returned to confirm his death and then called the police, who had been notified in advance. Euthanasia is still classified as an unnatural death and a coroner must confirm it and ensure all paperwork has been completed as part of the legal process. Once that was done, and after sitting there for a while, still stunned, we informed the rest of the family. The grandchildren started coming, the funeral directors came by, many phone calls were made.

We were lucky, not only because my mom had this option, which she chose, but also because we all supported her in this decision. But, in saying this, neither of us could have stopped the process. It was his decision and his only. Having a united family surely made this experience a shared experience, but without her strength and conviction, it would not have been possible.

My mother was brought up in the Catholic religion and has remained loosely tied to the church. She always watched the Pope at Easter and made sure to hear her Urbi et Orbi, but she didn’t go to church. Many candles lit in churches must have made up for this. She was also a practical woman, who understood that the end of her life would become more and more painful. And finally, she loved the attention and the drama, but realized that she was too tired to enjoy it. For her, euthanasia was an option. This is not the case for everyone, but we are grateful to him for having been able to take advantage of it. For my father, sisters, brother and I, strange as it sounds, it is a positive memory.

Source link

]]>
https://brainethics.org/2021/09/18/my-mother-died-by-euthanasia-for-my-family-this-day-is-a-positive-memory/feed/ 0
San Diego synagogue shooter avoids death penalty by pleading https://brainethics.org/2021/09/18/san-diego-synagogue-shooter-avoids-death-penalty-by-pleading/ https://brainethics.org/2021/09/18/san-diego-synagogue-shooter-avoids-death-penalty-by-pleading/#respond Sat, 18 Sep 2021 00:04:31 +0000 https://brainethics.org/2021/09/18/san-diego-synagogue-shooter-avoids-death-penalty-by-pleading/

A 22-year-old former nursing student has pleaded guilty to the murder of one person and attempted murder of 53 others in a deadly shooting at a Southern California synagogue, ending the possibility of ‘incur the death penalty.

SAN DIEGO – A 22-year-old former nursing student has pleaded guilty to the murder of one person and attempted murder of 53 others in a deadly 2019 shooting at a Southern California synagogue the latest Passover Day, thus ending the possibility of incurring the death penalty.

John T. Earnest pleaded guilty on July 20 to state charges in San Diego Superior Court and then agreed to serve the rest of his life in state prison without the possibility of parole. Sentencing is scheduled for September 30.

In the federal case, the sentence was set for December 28. Defense lawyers and prosecutors also recommend a life sentence, plus 30 years, according to the plea.

Federal prosecutors had previously said they would not seek the death penalty, and Friday’s plea deal finalized that decision. In July, the Justice Department suspended all federal executions after a series of death sentences unprecedented in the Trump administration, although the order does not bar prosecutors from seeking the death penalty. Attorney General Merrick Garland, who said he had reservations about the death penalty, declared the moratorium as officials reviewed government policies and execution protocols.

Earnest opened fire with a semi-automatic rifle on the last day of Passover services in April 2019 at Chabad of Poway, northeast of San Diego. The attack killed Lori Gilbert-Kaye, 60, and injured three others, including an 8-year-old girl and the rabbi, who lost a finger.

After Earnest emptied his initial magazine, several devotees rushed at him. Earnest fled in his car and soon after called 911 and confessed that he had just “blown up a synagogue”. Earnest was apprehended by local law enforcement who found the rifle and additional ammunition in his car.

In his plea on Friday, he admitted that he also set fire to a mosque in Escondido on March 24 with seven people sleeping inside, although no one was injured.

He said he carried out the attacks because he wanted to kill Muslims and Jews.

In May 2019, a federal grand jury indicted Earnest with 113 counts, to which he pleaded guilty on Friday.

“This nation stands in solidarity with the family of Lori Gilbert Kaye and the survivors of these unspeakable acts of terror,” Interim US Attorney Randy S. Grossman said in a statement. “We categorically reject the hatred, racism and prejudice of the accused, and we hope that the conclusion of this case will bring some comfort to all those affected by his heinous crimes.”

]]>
https://brainethics.org/2021/09/18/san-diego-synagogue-shooter-avoids-death-penalty-by-pleading/feed/ 0
NSW is alone on voluntary euthanasia after landmark bill passed in Queensland https://brainethics.org/2021/09/17/nsw-is-alone-on-voluntary-euthanasia-after-landmark-bill-passed-in-queensland/ https://brainethics.org/2021/09/17/nsw-is-alone-on-voluntary-euthanasia-after-landmark-bill-passed-in-queensland/#respond Fri, 17 Sep 2021 20:11:03 +0000 https://brainethics.org/2021/09/17/nsw-is-alone-on-voluntary-euthanasia-after-landmark-bill-passed-in-queensland/

New South Wales could have been the first state to legalize voluntary assisted dying (VAD), but is now on its own after Queensland passed its own euthanasia bill this week.

In 2017, NSW had the opportunity to become the first Australian jurisdiction to legislate on distance selling, but the bill did not pass the Upper House by a single vote.

Victoria, days later, became the first to take this historic milestone and on Thursday Queensland became the fifth state to legalize voluntary euthanasia.

Sydney Independent MP Alex Greenwich will bring forward another VAD bill to take over state parliament next month – with support from all political circles.

Mr Greenwich will introduce a bill on assisted dying to Parliament when it is resumed next month.(

AAP: Mick Tsikas

)

Shayne Higson, vice chair of the Euthanasia advocacy group Dying with Dignity NSW, said she was “thrilled” to see the Sunshine State pass the VAD bill, especially with a majority of 61 in 30.

“These laws are indispensable, they are compassionate, we are very happy that the bill was also passed without being amended,” Ms. Higson said.

Opponents who voted against the legislation in 2017, including Hugh McDermott of NSW Labor and Fred Nile, founder of the Christian Democratic Party (CPD), told the CBA they would fight the bill again.

“I don’t see any change, no real difference between now and then,” McDermott said.

“Putting a situation in the law, where you can appoint to commit suicide, is simply unacceptable, in my opinion.”

Reverend Nile said he was disappointed with Queensland and said he sent a “dangerous statement”.

People with chronic illnesses and others directly affected by the bill will follow the proceedings closely.

Sydney woman Judith Daley has been hospitalized more than 50 times since being diagnosed with chronic inflammatory lung disease (COPD) 20 years ago and lung cancer years later.

The 77-year-old from Alexandria, a suburb of Sydney, and a board member of Dying with Dignity NSW, has had radiation treatment more than 32 times and when doctors offered chemotherapy again, She refused.

“My oncologist said there was a 5 to 10 percent chance that the chemotherapy would work,” Ms. Daley said.

Ms Daley said she did not want to die but knew there might come a day when living was “no longer tolerable”.

“At the moment I don’t want to die. I have had a wonderful life and I still hope that it can improve after the operation I had in August,” she said.

“But… I don’t know when I’m suddenly going to get worse and I want control, to know that I can do something about it.”

A smiling Judith Daley
Ms Daley is hopeful after having surgery, but knows her condition could worsen. (

Provided

)

Voluntary euthanasia in Australia enjoys overwhelming support within the community, according to several surveys.

A Roy Morgan poll commissioned by Dying with Dignity in 2017 found that 87% of Australians supported ‘letting patients die’ if they were ‘desperately ill’ or ‘in incredible pain’.

These numbers were corroborated by a 2019 ABC Vote Compass poll which found overwhelming support for euthanasia, regardless of political or religious affiliation.

West Sydney voters of Blaxland, McMahon and Parramatta were the least in favor of physician-assisted dying, according to Vote Compass data.

Mr. McDermott, whose Prospect electorate also crosses in West Sydney, said his constituents wrote to him regularly to express their opposition to the VAD.

NSW Member for Prospect Hugh McDermott
Hugh McDermott of the Labor Party voted against the bill in 2017.(

Provided

)

“Despite what pro-euthanasia groups are saying, there is significant resistance to these laws,” he said.

Like many in the debate, Mr. McDermott’s position was deeply personal. When his father was diagnosed with cancer, he expressed a desire to be voluntarily euthanized.

“It went on for a few months and during that time he reconciled with a lot of family members, he got his house in order,” McDermott said.

“He fought to the end.

Ms. Higson of Dying with Dignity, however, said this person “deserves the right to a peaceful death”.

“Another advantage is that it would allow these people not to reach such a desperate stage and to be able to have an open and honest conversation with the doctors and their families,” she said.

Dying with Dignity Vice President Shayne Higson
Dying with Dignity Vice-Chair Shayne Higson outside the New South Wales Parliament, calling for support for assisted dying.(

Provided

)

The state parliament has not sat since June due to the Delta outbreak and the bill’s sponsor, Mr Greenwich, used this period to make further amendments.

A revised bill is expected to contain provisions not seen anywhere else in the country, including improved communication and support for residents of elderly care facilities.

The national MP who introduced the bill four years ago, Trevor Khan, has said that passage of the bill would be “inevitable”, if not this round, then certainly the next.

“There is a lot of support between the parties this time around, but the numbers are very difficult to assess with precision,” Khan said.

“I think it will be close.”

Source link

]]>
https://brainethics.org/2021/09/17/nsw-is-alone-on-voluntary-euthanasia-after-landmark-bill-passed-in-queensland/feed/ 0
MO Governor Mike Parson won’t stop Ernest Johnson’s execution https://brainethics.org/2021/09/17/mo-governor-mike-parson-wont-stop-ernest-johnsons-execution/ https://brainethics.org/2021/09/17/mo-governor-mike-parson-wont-stop-ernest-johnsons-execution/#respond Fri, 17 Sep 2021 14:33:20 +0000 https://brainethics.org/2021/09/17/mo-governor-mike-parson-wont-stop-ernest-johnsons-execution/

Part of Ernest Lee Johnson's brain was removed during surgery to remove a tumor.  He now has the mental capacity of a child.

Part of Ernest Lee Johnson’s brain was removed during surgery to remove a tumor. He now has the mental capacity of a child.

Missouri cannot legally execute Ernest Lee Johnson, 61, on October 5. Because the Supreme Court has always held that killing someone so cognitively disabled would violate the Eighth Amendment ban on cruel and unusual punishment.

The Missouri Supreme Court ruled last month that Johnson, who had part of his brain removed with a tumor in 2008, cannot be so disabled because he planned the murder at the 1994 closure of three employees of a Columbia convenience store – Mary Bratcher, Mable Scruggs and Fred Jones.

But former Missouri Supreme Court Justice Michael Wolff ruled against the ruling: “Mr. Johnson is a person with such severe intellectual disabilities that a reasonable jury would not have recommended execution. By constitutional standards, his execution would constitute a cruel and unusual punishment in violation of the Constitution as interpreted for decades in the decisions of the Supreme Court of the United States.

Because we met Missouri Gov. Mike Parson, who has spent much of his time in office pretending COVID-19 is the same as a cold and Kevin Strickland is guilty of murder, we dare not not even hope that the proof that Johnson today has a child’s conscience could convince our governor to commute his sentence.

But when the state, our state, kills this man, as it almost certainly will, it will be another indictment against a system so bloodthirsty that it delights in taking revenge on those who don’t even know why they are punished.

As capital punishment opponent Sister Helen Prejean says, there are no millionaires on death row. And even among the culprits, there are few who have not themselves been mistreated or injured to the point of incapacitation.

In reinstating the federal death penalty last year, after a 17-year hiatus, then Attorney General William Barr said we would execute “the worst criminals.” Instead, those put to death personified almost every argument against capital punishment.

The 10 federal prisoners executed in 2020 – the most in a single calendar year for more than a century – included a man with such advanced Alzheimer’s disease he didn’t know why he was killed and two men who were teenagers at the time. of their crimes. On our behalf, the government executed a Native American whose crime was committed on tribal lands, despite the Navajo Nation, which should have had sovereignty, oppose the death penalty. We killed a black man convicted by an all-white jury. And a man with such a low IQ that he too should have been disqualified because he was functioning too poorly to be put to death.

Republican St. Louis McCloskeys obtained governor’s pardon

Parson has the power to stay Johnson’s execution and appoint a five-member commission of inquiry that would have the power to subpoena evidence and compel witnesses to testify. The council would then recommend to Parson whether Johnson should be executed or if his death sentence should be commuted to life in prison without parole.

Again, he won’t, as his compassionate reserves were spent to pardon St. Louis attorney Mark McCloskey, the Republican candidate for the US Senate, and his wife Patricia, who pleaded guilty to assault afterwards. brandishing guns against Black Lives Matter protesters the last time around. year.

And no, this won’t be the first time that Missouri officials have ignored the U.S. Constitution in favor of a poll that says you can never go wrong in punishing the pathetic.

In 2015, Cecil Clayton, 74, was put to death despite severe mental illness, dementia and intellectual disabilities related to his advanced age. He also suffered serious brain damage from injuries sustained in a sawmill accident.

On July 16, 2014, John Middleton was put to death despite various mental health issues. The day before, a federal judge in Missouri suspended Middleton’s execution. The judge, Catherine Perry, feared that Middleton was mentally incompetent and ineligible for the death penalty. But Missouri officials executed him anyway.

In this week’s latest court case, Johnson’s legal defense team again argued that Johnson meets all legal and clinical definitions of intellectual disability. But Johnson does not have a mental disability and must die, argued Missouri Attorney General Eric Schmitt’s office.

The crime of which Johnson was convicted was heinous. All three victims were beaten with a claw hammer. One was shot and another was stabbed with a screwdriver. All were found in a cooler inside the store.

When we kill this man, we’ll do what he did. But because of his brain tumor, the already weakened man who committed these murders no longer even exists. And we won’t let that stop us either, will we?

This story was originally published September 17, 2021 5:00 a.m.

Kansas City Star Related Stories

]]> https://brainethics.org/2021/09/17/mo-governor-mike-parson-wont-stop-ernest-johnsons-execution/feed/ 0 Advocates eye national holdouts after historic Qld euthanasia vote https://brainethics.org/2021/09/17/advocates-eye-national-holdouts-after-historic-qld-euthanasia-vote/ https://brainethics.org/2021/09/17/advocates-eye-national-holdouts-after-historic-qld-euthanasia-vote/#respond Fri, 17 Sep 2021 09:30:00 +0000 https://brainethics.org/2021/09/17/advocates-eye-national-holdouts-after-historic-qld-euthanasia-vote/

After Victoria, Western Australia, South Australia and Tasmania, the Queensland approach is broader. But the practice, also known as voluntary aid in dying, will always be reserved for adults with advanced and progressive disease causing intolerable suffering.

Loading

They will need to have decision-making capacity, receive two assessments by separate physicians, and make three separate requests over a nine-day period.

Supported by extensive work by the state law reform commission, it will extend eligibility to those who are 12 months old, starting from the six month window in other states. Doctors will also be able to raise issues with patients.

While individual health practitioners may have objected under other public schemes, private faith-based institutions are also distinguished in Queensland law: they will also be able to refuse to participate but must not impede access to the public. ‘a person through outpatient health care. workers or a transfer.

Even still, the supporters would like it to go further. Perron believes there should be no need for a prognosis at the time of death, only a diagnosis of terminal illness.

“I don’t think 10 years ago Queensland was ready for these laws,” she said during her contribution to two days of personal and emotional speeches during debate on the bill this week. before a rare vote of conscience of the big party.

Some in the state still weren’t ready, others probably never will.

Deputy LNP opposition leader and shadow attorney general David Janetzki, who did not support the bill, introduced 54 amendments, including allowing faith-based establishments to ban euthanasia on their premises, which failed .

Katter’s Australian party – whose three MPs voted against the bill – have tried to delay debate until funding for palliative care is increased. This motion was rejected by 53 votes to 37.

Loading

Given the support of the Prime Minister and many high-ranking members of the government, as well as the successful campaign to decriminalize abortion in 2017, supporters were hopeful but still unsure of what would happen when the vote began. .

That the bill which finally passed through the 93 seats of Parliament intact, with a vast majority (61 votes to 30) and during its first presentation (where other jurisdictions had debates, or unsuccessful attempts, in the past) has been well received by supporters to put it mildly.

Catholic Health Australia, which represents groups providing one in five hospital beds and elderly care in the state, said the bill puts the sites in a “heinous and extraordinary position”.

Pro-life group Cherish Life said MPs supporting the bill had “abdicated their responsibility to protect the most vulnerable.”

Two prominent end-of-life researchers – QUT professors Ben White and Lindy Willmott – whose work has informed euthanasia laws in all other states, said Mr Janetzki’s amendments would have made the law already balanced “Heavy, inconsistent and impractical”.

Despite the long campaign, the end result still produced surprising results for Muir, especially in the Gold Coast region.

More than expected, six of the 10 LNP members who backed the bill hold electorates in the region, in which LNP leader David Crisafulli – who voted against – is also based.

Muir said the region’s “very influential” self-funded retiree base, many of whom are LNP voters, had told him they wanted the laws passed. He also believes the Labor campaign in some other LNP core seats changing hands in the October election could have come down to voters looking for the program.

Outside Queensland, the New South Wales Parliament could see a debate on the issue again as early as next month as part of a bill being prepared by Independent Sydney MP Alex Greenwich.

Loading

Despite longstanding opposition to voluntary euthanasia, there are even signs of a shift in elements of the Australian Medical Association branch of the state. But Liberal Prime Minister Gladys Berejiklian and Labor Party leader Chris Minns personally oppose the laws.

While Berejiklian’s preference is to focus on the captivating challenge of the COVID-19 state, Muir said there was precedent for her to “step up” and support reform as part of her legacy. It came from the Liberal Premiers of Tasmania and South Australia who supported non-government bills.

Beyond that, attention also turns to ACT and NT. There, the political will exists but is blocked by a bill introduced by outgoing federal deputy Kevin Andrews to overturn the latter’s first attempt the same year.

Despite the federal government’s lack of appetite for the necessary repeal or the drafting of new legislation, Perron hopes the tide is turning.

“Competitive federalism works, and that is exactly what it is,” he says. “States learn from each other and try to be the best.”

The Morning Edition newsletter is your guide to the most important and interesting stories, analysis and ideas of the day. register here.

Source link

]]>
https://brainethics.org/2021/09/17/advocates-eye-national-holdouts-after-historic-qld-euthanasia-vote/feed/ 0
Phylogeographic reconstruction of the origin of marbled crayfish https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/ https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/#respond Fri, 17 Sep 2021 09:14:48 +0000 https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/

Procambarus fallax PCR collections and genotyping

Animals were collected from various wild populations (Table S1) in accordance with state and local regulations (Georgia Department of Natural Resources Scientific Collection Permit 115621108, Florida State Collection Permit S-19-10 and S- 20-04). DNA was isolated from abdominal muscle tissue using SDS-based extraction and precipitation with isopropanol. PCR genotyping of 92 specimens was carried out using the following primer pairs: Cytb (FWD CAGGACGTGCTCCGATTCATG and REV GACCCAGATAACTTCATCCCAG), Dnmt1 (FWD GCTTTCTGGTCTCGTATGGTG and REV CTGCACACAGCCD CATTGATGACT (CTATT). Amplicons were verified by agarose gel electrophoresis and cloned using the TOPO TA cloning kit (Invitrogen) according to the manufacturer’s instructions. The purified plasmids were sequenced by eurofins genomics and the sequences were aligned using SnapGene software.

Procambarus virginalis Sequencing and assembly of the PacBio genome

Genomic DNA was isolated from three independent animals using SDS extraction and precipitation with isopropanol. The preparation of the large PacBio insert library was performed following the protocols recommended by Pacific Biosciences. For each animal, a library was generated of 1 to 5 μg of sheared and concentrated DNA with a target of insert size of approximately 10 kb. After preparation of the library, the sequencing was performed on a PacBio SEQUEL platform according to the manufacturer’s instructions. Film times were 600 for most SMRT cells, some being 240, 360 and 900. Sequencing results for animals were pooled, resulting in a total of 37 SMRT cells comprising 69,074,290 reads and 242,146,920,794 bases.

The long sub-reads generated from the PacBio SEQUEL platform were assembled into contigs using the Canu assembler25 version 1.7. After automatic error correction and cropping for the read quality estimates and the SMRT cell adapters, the remaining 31,652,687 reads, comprising 91,697,556,862 bp, were used in the assembly phase. The calculations were performed on a high performance cluster running Slurm Workload Manager using up to 56 processors and 450 GB of memory. To obtain an improved representation of the genes, the contigs were connected using information from the transcriptome. In short, all the transcripts were mapped to the contig assembly and the linkage information was extracted to connect the contigs using L_RNA_SCAFFOLDER26 version 1.0. Sequence adjacency was improved using proximity ligation based on the Chicago and Hi-C methods (supplied by Dovetail Genomics, Chicago, USA) using fresh frozen tissue from an additional animal. After DNA extraction and library preparation, the libraries were on an Illumina HiSeq X platform using a 150 bp sequencing protocol without PCR. Readings were processed for scaffolding and error correction using the HiRise scaffold pipeline from Dovetail (Dovetail Genomics, Chicago, USA).

Automatic annotation was performed as described previously8. Briefly, sequences greater than or equal to 10 kb were extracted from the assembly and annotated using the MAKER pipeline.27 version 3.00. The annotation data was provided by the manually managed Uniprot / Swiss-Prot database28 and the annotated marbled crayfish transcriptome8. Functional domains were predicted using InterproScan29 versions 5.39–77.0.

In order to assess the quality of the assembly, a defined set of single copy orthologous arthropod genes was searched in all sequences using BUSCO.18 version 4.1.4. BUSCO was run using the default settings in genome mode with the provided arthropod sequence database, containing a total of 1066 orthologs from the arthropoda_odb10 database. The taxonomic query was performed using blobtools30 version 1.1.1, the P. virginalis Petshop 1 WGS Dataset8, and the blast nucleotide database as the hits database. Blobtools was run according to the workflow provided by first creating a BlobDB database using standard parameters, followed by a visualization.

Procambarus fallax whole genome sequencing

Illumina libraries for 28 samples were prepared by the DKFZ Genomics and Proteomics Core Facility using standard and sequenced procedures on an Illumina HiSeq X platform (PE150 protocol). Raw reads were cropped and filtered using Trimmomatic31 version 0.32.

Analysis of whole genome sequencing data

Cropped and processed reads were mapped to the P. virginalis mitochondrial genome sequence (Genbank KT074364.1) or on V1.0 genome assembly using bowtie232 version 2.1.0. Alignment files have been converted to BAM format and duplicates have been removed with SAMtools33, version 1.9. In addition, the alignment files have been filtered for reference sequences greater than 10 kbp. Multi-sample SNV profiles were calculated for batches of P. fallax animals using freebayes (https://arxiv.org/abs/1207.3907, version v0.9.21-7-g7dd41db) with a ploidy parameter for diploid organisms. Variant sites obtained from vcf files were subjected to linkage pruning using PLINK34 version 1.9 and specific window settings (50 KB), window step sizes (10 bp), and R2 threshold (> 0.1). The resulting set of variants was used for principal component analysis (PCA) using the default settings in PLINK and plotted using the ggplot2 package in R (version 3.2.1). The alignment files for the mitochondrial genomes were used for the consensus call by the SAMtools bcftools package. The consensus sequences obtained from P. fallax mitochondrial genomes with P. virginalis Reference mitochondrial genome were aligned using Clustal Omega with default settings. For the resulting multiple sequence alignment, a phylogenetic tree was constructed by the maximum likelihood method implemented in PhyML35 (v3.1 / 3.0). The tree in Newick format was visualized via the Interactive Tree of Life online tool36, with statistical branch support evaluated by the bootstrap method37.

To detect parental nuclear alleles of P. virginalis, SNV profiles of all P. fallax the animals were compared to the set of heterozygous mottled positions specific to crayfish. A matrix was constructed for each mottled crayfish allele (majority and minority allele) containing either 0 or 1, representing the presence or absence of the respective alleles in P. fallax animals. A neighbor-to-join distance matrix was calculated for each allele and an unrooted tree was plotted using the APE38 version 5.3. To identify triploid genomes, biallelic heterozygous variants were extracted from SNV profiles. By focusing only on the reference alleles, homozygous single-nucleotide polymorphisms in P. fallax were thrown away. For each variant position, the alternate allele frequencies were calculated as the number of observations of alternate allele readings divided by the total reading depth. Finally, frequencies were plotted using the histogram routine in R (version 3.6.1).

Statistics and reproducibility

All statistical methods and visualizations were performed using publicly available tools and packages of Statistical Calculation Framework R. Individual packages, settings and version numbers are mentioned in the respective sections. Link pruning was done using PLINK34 (v1.9) and one internal r2 statistical threshold of> 0.1 for the squared correlation of the numbers of raw intervariant alleles. Principal component analysis was performed using the internal default R function with standard parameters. The reconstruction of the phylogenetic tree was carried out by the maximum likelihood method implemented in PhyML35 (v3.1 / 3.0) with default settings. Here, the statistical support for each branch was assessed using the bootstrap method37. Histogram plots for heterozygous allele frequencies were generated using the default internal R histogram function (v3.6.1).

This study includes data for the PCR genotyping of NOT = 92 P. fallax specimens. For each animal, the total number of genetic polymorphisms on 3 gene fragments was extracted and plotted on a scale of 0 (minimum) to 21 (maximum) using the internal R (v3.5.0) heat map function with parameters by default. In addition, data from NOT = 4 copies of P. alleniwere sequenced and integrated. Replicates were defined as a group of individuals with distinct animals of a species (i.e., NOT = 92 for P. fallax and NOT= 4 for P. alleni). Analysis of whole genome sequencing data was performed on NOT= 28 P. fallaxanimals collected from 23 independent collection sites in Florida and South Georgia. Besides, NOT= 2 publicly available WGS datasets from P. virginalissamples were taken into account for this study. Here, repeats were also defined as the number of individual animals of a species.

Summary of the report

Further information on the research design can be found in the Nature Research Report Summary linked to this article.

Source link

]]>
https://brainethics.org/2021/09/17/phylogeographic-reconstruction-of-the-origin-of-marbled-crayfish/feed/ 0
How to watch alien movies in order https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/ https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/#respond Thu, 16 Sep 2021 23:29:00 +0000 https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/

“Alien” takes place in 2122, 17 years after “Alien: Covenant”. But, despite this short span of time, there is a lot going on in between. “Covenant” continued to put vital information into spin-off media. Peter Weyland’s company became Weyland-Yutani not on screen, but in a book by Alan Dean Foster. “Origins,” released months after the film’s debut, describes how Yutani’s CEO attacked Weyland Corp after Peter’s death, explaining why the settlers were flying under a familiar corporate banner.

There were also two other “Alien: Covenant” shorts produced after the film’s release. One, “Advent”, was included on the DVD. This is David’s thesis on how to create a higher being, posted to Weyland-Yutani. In grotesque autopsy footage, David defiles Dr. Shaw as he talks about perfecting his creation. “Advent” also makes it clear that Daniels, one of the two surviving Alliance settlers, is destined to be part of the first Queen Xenomorph. It is an act that will ensure the future replication of the species.

The other movie, “David’s Lab – Last Signs of Life”, was released on YouTube as a birthday present. Twelve minutes is too slow for what it offers. Weyland-Yutani sent an expedition to study David’s lab, and of course one of David’s new facehuggers takes a bite out of the newcomers.

Source link

]]>
https://brainethics.org/2021/09/16/how-to-watch-alien-movies-in-order/feed/ 0
Another Texas death row inmate sees execution delayed after alleged religious freedom violation – CBS Dallas / Fort Worth https://brainethics.org/2021/09/16/another-texas-death-row-inmate-sees-execution-delayed-after-alleged-religious-freedom-violation-cbs-dallas-fort-worth/ https://brainethics.org/2021/09/16/another-texas-death-row-inmate-sees-execution-delayed-after-alleged-religious-freedom-violation-cbs-dallas-fort-worth/#respond Thu, 16 Sep 2021 22:17:00 +0000 https://brainethics.org/2021/09/16/another-texas-death-row-inmate-sees-execution-delayed-after-alleged-religious-freedom-violation-cbs-dallas-fort-worth/

HOUSTON (CBSDFW.COM/AP) – Another Texas death row inmate has had his execution delayed over allegations the state is violating his religious freedom by not letting his spiritual advisor lay his hand on him during his lethal injection.

Ruben Gutierrez was to be executed on October 27 for fatally stabbing an 85-year-old Brownsville woman in 1998.

READ MORE: Fort Worth residents worried about plans to replace the nearly 100-year-old Forest Park swimming pool

But on Wednesday, September 15, a judge granted a request from the Cameron County District Attorney’s office to set aside the execution date.

Ruben Gutierrez (credit: Texas Department of Criminal Justice)

Prosecutors said the upcoming U.S. Supreme Court review of similar religious freedom issues posed by fellow inmate John Henry Ramirez, whose execution was delayed by the High Court last week, will have a impact on the case of Gutierrez.

“As the Ramirez case can be decisive in any matter related to Gutierrez’s claim for religious freedom, it is in the best interest of the state, the family of the victim of Gutierrez’s crimes, that his execution be delayed,” prosecutors said in a filed motion. Tuesday.

Gutierrez was previously within one hour of execution in June 2020 when the Supreme Court granted him a stay because his spiritual advisor was not allowed to accompany him to the death chamber.

Last month, attorneys for Gutierrez filed a lawsuit in federal court alleging that the Texas Department of Criminal Justice violated his right to practice his religion by denying his request to have his priest touch his shoulder, praying aloud. voice and perform the last rites during its execution.

Gutierrez, 44, said those three things had to be done “to secure my path to the afterlife,” according to his complaint.

His lawyers cited the First Amendment to the Constitution and a federal law that protects the religious rights of an inmate.

Ramirez made similar claims when he got a suspension.

The Supreme Court has dealt with the presence of spiritual advisers in the death chamber in recent years, but has not made a final decision on the matter.

That could change after hearing oral arguments in the Ramirez case on November 1.

The court was criticized after refusing to stop the February 2019 execution of Alabama inmate Domineque Ray for his request to have his Islamic spiritual advisor in the death chamber, but a month later, he granted a reprieve to Texas inmate Patrick Murphy, who wanted his Buddhist spiritual advisor in the bedroom.

READ MORE: Cook Children Halts Elective Surgeries Due to Staff and Bed Shortages During COVID-19 Outbreak

Since then, the Supreme Court has delayed several executions following requests from spiritual advisers.

After the court stopped Murphy’s execution, the Texas prison system banned any clergy from entering the death chamber.

Texas previously allowed clergy employed by the state to accompany inmates, but its prison staff included only Christian and Muslim clerics.

In April, the Texas prison system revoked its two-year ban.

The new policy allows an inmate’s approved spiritual advisor to be in the bedroom, but the two cannot have any contact and voice prayers are not allowed during execution. Texas prison officials say direct contact poses a safety risk and vocal prayer could be disruptive.

Robert Dunham, executive director of the Death Penalty Information Center, said the Ramirez case is an opportunity for the Supreme Court to determine whether detainees have the right to spiritual counsel in a death chamber and, if so, what is permitted in the exercise of that right.

“The fact that this case may provide the court with an opportunity to chart a course for what is and what is not acceptable is no guarantee that they will,” said Dunham, whose The group does not take a position on the death penalty but has criticized the way in which states carry out executions.

If the Supreme Court does not provide clear guidelines, this question will arise continually, Dunham said.

Gutierrez has long argued that he did not kill Escolatica Harrison in what prosecutors called an attempt to steal more than $ 600,000 the elderly woman had hidden in her home.

His lawyers have requested DNA tests which they believe could point to the real killer.

Prosecutors said the request was a “ruse” and that Gutierrez was convicted on the basis of various evidence, including a confession.

NO MORE NEWS: COVID-19 vaccines don’t affect fertility, but virus does, doctors say

(© Copyright 2021 CBS Broadcasting Inc. All rights reserved. The Associated Press contributed to this report.)

]]>
https://brainethics.org/2021/09/16/another-texas-death-row-inmate-sees-execution-delayed-after-alleged-religious-freedom-violation-cbs-dallas-fort-worth/feed/ 0
Supergirl: Season 6, Episode 11 recap and spoilers https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/ https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/#respond Thu, 16 Sep 2021 21:21:28 +0000 https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/

WARNING: The following contains spoilers for Supergirl Season 6, Episode 11, “Mxy in the Middle,” which aired Tuesday on The CW.

Season 6 of Super girl built the menace of the 5th dimensional pixie princess Nyxlygsptlnz as the series’ final cosmic menace. Picking up where “Still I Rise” left off, “Mxy in the Middle” begins with the arrival of Mister Mxyzptlk, also known as Mxy, after being summoned by Supergirl. The other 5th dimensional pixie comes to her aid against the princess, defending Supergirl from Nyxly’s blasts. The two manage to escape and regroup with J’onn and the others, without Kelly facing the fallout from the building destroyed by Nyxly.


Unable to do magic without Nyxly tracking him down, Mxy performs a musical number to the tune of “I Will Survive”, with the lyrics exchanged for Nyxly’s life story. Nyxly and her brother conspired to overthrow their father, Mad King Brpxz, but were caught red-handed. The king disowned Nyxly, while his brother received praise for his ferocity. While showing how the fictional patriarchs are just as unfair as the real ones, this story is the opposite of what Nyxly initially told Kara. She stated that King Brpxz killed her brother, although Mxy believes she was speaking metaphorically, as Nyxly considers her brother to have died for her.

RELATED: Supergirl: CatCo Can’t Beat Iris West’s Beloved Citizen Report

supergirl mxy singing for i will survive

The most important part of Mxy’s song is about the AllStone, an incredibly powerful item created by an evil pixie named Jyrryd. The AllStone was meant to give the Imp in control of everything, even life and death. The other 5th dimensional imps weren’t so excited about his plan, banishing Jyrryd and blowing up the AllStone. The broken pieces have become totems. Every planet has a set, according to Mxy. Nyxly wants to collect the totems to create a new AllStone, although this is made difficult by the fact that the totems can be disguised as anything. To get around this, she uses a crystal owned by Jyrryd that can hunt down totems, though she needs one more thing for this to work: a descendant of Jyrryd to stay inside the orb. In a somewhat convenient twist, Mxy reveals that he is Jyrryd’s last descendant, making him Nyxly’s target.

Throughout the episode, Nia struggles with the guilt of being the one who freed Nyxly. This guilt is even worse when Kara begins to blame herself for Nyxly’s appearance, as she believes she brought Nyxly into the real world from the Phantom Zone. After confiding in Brainiac 5 and showing how far their relationship has come in terms of trust, Nia also reveals the truth to Supergirl. Expecting to be hated by her hero, Nia is relieved when Kara realizes that Nia simply made a mistake, as they all have done in the past.

Examining blueprints for the device Nyxly used to restore her powers, the Superfriends hatch a plan to use a magically powered sinking armband to weaken Nyxly. Mxy offers an amulet which he hid after Mon-El used it to fight the Imp. Without being able to use his magic, Mxy finds his help worthless as the team works on the device. Eventually summoned downtown to fight a giant cat summoned by Nyxly, the pixie gives the team a two-hour deadline to hand Mxy over. Mxy brings up the idea of ​​cloning himself to cheat Mxy, although his clone quickly disintegrates. Supergirl and Nia improve on this idea by having Nia take on the appearance of Mxy to get close enough to Nyxly to use the armband on her.

RELATED: Supergirl’s Final Season Presents a Landmark Guardian Moment

supergirl mxy and dreamy

Dreamer uses Brainy’s Image Inductor to mimic Mxy’s appearance, and she and Supergirl go to meet Nyxly. Unfortunately, the power-cushioning armband disrupts Dreamer’s illusion, which leads Nyxly to capture the Superfriends to lure Mxy. She summons a Kryptonite-breathing dragon to threaten the team, while also telling them how Mxy said he would support Nyxly in overthrowing her father, only for Mxy to vouch for her during the trial. Mxy arrives and saves the Superfriends, wanting to make up for his past actions, but gets captured by Nyxly in the process. While sealed in the orb, Mxy manages to get the Power Damping Armband on Nyxly before she returns to her ship.

The Superfriends regroup and agree to try to save Mxy while preventing Nyxly from recreating the AllStone. Mitch, the alien criminal used by Nyxly to help her regain her powers, only saved Nyxly so that she could give him a better life with her powers. Powerless again, Nyxly agrees to grant his wishes if they manage to find the totems, starting with the totem of courage. Nia sees this in her dreams, letting the Superfriends know what Nyxly’s next move is. It is not yet clear whether the totems are meant to be real people like the Paragons in Crisis were, or if they are just everyday items. Either way, Plot A ends with the set setting for the Superfriends to pursue Nyxly and save Mxy.

For the episode’s plot B, Lena is visiting her mother’s hometown. She and Andrea talk on the phone about a photo of Lena’s mother, Elizabeth, and her two childhood friends. Lena asks Andrea to locate a girl in the photo, Florence, which the CEO of CatCo happily accepts. Lena’s arrival in town is less than welcome, as bed and breakfast and pub owners are throwing her out. The owner of the pub, named Peggy, is the daughter of Margaret Bishop, the other woman pictured with Elizabeth and Florence. Peggy reveals to Lena that their mothers were in a coven together and that Elizabeth allegedly killed Margaret.

RELATED: Supergirl’s Chyler Leigh Teases Series Finale Full of Bittersweet Tears

supergirl lena with florence

Already overwhelmed by her Luthor side, Lena wants to give up and go home. Andrea calls back with information about Florence and urges Lena to continue searching for the truth. Arriving at what looks like a small hut in the woods, Lena finds Florence, who reveals that Elizabeth, Margaret and herself were in fact witches, who pursued Margaret’s husband after learning he was beating her. . What was intended as a scare tactic accidentally turned into murder when the three lost control of their magic and set the hangar on fire. Florence ends by telling Lena that she inherited her mother’s gift, which the scientist finds it hard to believe.

In terms of the main story, “Mxy in the Middle” does a great job of preparing for the home stretch by facing Nia’s guilt and focusing primarily on the battle to stop Nyxly. Foreground is Dreamer’s character development, with her able to interpret her dreams, while maintaining a healthy and honest relationship with Brainy. On the other hand, the plots of characters like Kelly and Lena seem to have gotten lost in the process. Kelly still hasn’t donned the Guardian armor, though the teaser for next week’s episode seems to finally be making its debut. With only a few episodes remaining on the show, it’s a shame Kelly didn’t have more time to dress up and show off her skills.

This leads to the other hanging story: Lena’s magical ability. Lena’s journey to find the motherly side of the family seemed like a natural progression for someone trying to get away from the craziness of her Luthor heritage. Elizabeth Walsh having a darker past than Lena knew, it even makes sense, but the sudden revelation that Lena’s mother was magical comes a little too late to do good. With only a few episodes remaining and one major threat to resolve, Lena’s development as a witch will be short and likely not so sweet for viewers who appreciated Lena as a great human character among the Superb. Lena’s magical abilities will likely play a role in the final battle against Nyxly, leaving it to fans to Super girl decide if another character becoming a superhuman so close to the end was really needed.

New episodes of Supergirl air Tuesdays on The CW.

KEEP READING: Why Supergirl Should End With No Romance For Kara

Marvel and if the Killmonger drones

Marvel just launched the MCU’s own Gundam army – with disastrous results


About the Author

Source link

]]>
https://brainethics.org/2021/09/16/supergirl-season-6-episode-11-recap-and-spoilers/feed/ 0